分離済み変異体

tm2256

Allele Name

tm2256

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T05D4.4

Gene Name

osm-7

Worm Base

Allele Name

tm2256

Gene Name

osm-7

Sequence

T05D4.4

Phenotype

homozygous viable. Dr. A. Hart: Plos Biol. 6, e196 (2008).

Mutation site

23507/23508-TC-23638/23639 (131 bp deletion + 2 bp insertion)

Chromosome

III

Putative gene structure

join(22064..22334, 22883..23055, 23269..23440, 23559..23698, 23854..23942, 24048..24159, 24220..24270, 24321..24533, 24867..25033, 25393..25500, 25546..25648, 26043..26538)

Map position

21.27

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CTCCTGGCCAACTGACCCAT,ExtRev:CGAGAGGCCACACTTACGCA,IntFwd:ACAGTAGCTAGTAGGCCTCT,IntRev:GGAAGCATAATGGTAGCGCT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Wimberly K, Choe KP.
An extracellular matrix damage sensor signals through membrane-associated kinase DRL-1 to mediate cytoprotective responses in Caenorhabditis elegans.
Genetics 2022 220(3)
[ PubMed ID = 34849856 ] [ RRC reference ]

Rodriguez Mendoza V, Chandler L, Liu Z, Buddendorff L, Al-Rajhi A, Choi T, Gibb G, Harvey J, Mihalik A, Moravec S, Pilcher W, Raju V, Choe KP.
Extracellular proteins OSM-7 and OSM-8 are required for stress response gene regulation at all post-embryonic stages.
MicroPubl Biol 2022 2022
[ PubMed ID = 36606078 ] [ RRC reference ]

Sorkaç A, DiIorio MA, O'Hern PJ, Baskoylu SN, Graham HK, Hart AC.
LIN-12/Notch Regulates GABA Signaling at the Caenorhabditis elegans Neuromuscular Junction.
G3 (Bethesda) 2018 8(8) 2825-2832
[ PubMed ID = 29950427 ] [ RRC reference ]

Bennett HL, Khoruzhik Y, Hayden D, Huang H, Sanders J, Walsh MB, Biron D, Hart AC.
Normal sleep bouts are not essential for C. elegans survival and FoxO is important for compensatory changes in sleep.
BMC Neurosci 2018 19(1) 10
[ PubMed ID = 29523076 ] [ RRC reference ]

Anderson EN, Corkins ME, Li JC, Singh K, Parsons S, Tucey TM, Sorkaç A, Huang H, Dimitriadi M, Sinclair DA, Hart AC.
C. elegans lifespan extension by osmotic stress requires FUdR, base excision repair, FOXO, and sirtuins.
Mech Ageing Dev 2016 154 30-42
[ PubMed ID = 26854551 ] [ RRC reference ]

Dresen A, Finkbeiner S, Dottermusch M, Beume JS, Li Y, Walz G, Neumann-Haefelin E.
Caenorhabditis elegans OSM-11 signaling regulates SKN-1/Nrf during embryonic development and adult longevity and stress response.
Dev Biol 2015 400(1) 118-31
[ PubMed ID = 25637691 ] [ RRC reference ]

Singh K, Chao MY, Somers GA, Komatsu H, Corkins ME, Larkins-Ford J, Tucey T, Dionne HM, Walsh MB, Beaumont EK, Hart DP, Lockery SR, Hart AC.
C. elegans Notch signaling regulates adult chemosensory response and larval molting quiescence.
Curr Biol 2011 21(10) 825-34
[ PubMed ID = 21549604 ] [ RRC reference ]

Komatsu H, Chao MY, Larkins-Ford J, Corkins ME, Somers GA, Tucey T, Dionne HM, White JQ, Wani K, Boxem M, Hart AC.
OSM-11 facilitates LIN-12 Notch signaling during Caenorhabditis elegans vulval development.
PLoS Biol 2008 6(8) e196
[ PubMed ID = 18700817 ] [ RRC reference ]