分離済み変異体

tm2253

Allele Nametm2253
BalanceCompleted
OutCrossNot Accepted
Sequence NameT08G5.5
Gene Namevps-39
Worm BaseAllele Name tm2253 (x1)
Gene Name vps-39
Sequence T08G5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. C. Yang: slightly Dpy, cell corpses degradation defects. Dr. H. Sawa: non Psa, lethal, defective in chromosome segregation. Dr. Z. Zhou: persistent cell corpses in adult gonad.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19127/19128-CATT-20172/20173 (1045 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(17925..18137, 18737..19320, 19377..19908, 19954..20243, 20288..20656, 20709..21001, 21046..21188, 21237..21445, 21496..21561, 21609..21681))
Map position6.08
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:ACCGCGTTAATTGCCGAGAA,ExtFwd:CTCGCTTGTCGTCCGGTAGT,IntRev:CGAGTACAAGTTCAGCGAAG,ExtRev:CGTCCGGCAAATGTATTAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241 
[ PubMed ID = 30160610 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev Cell 2014 28(1) 43-55 
[ PubMed ID = 24374177 ] [ RRC reference ]

Xiao H, Chen D, Fang Z, Xu J, Sun X, Song S, Liu J, Yang C.
Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans.
Mol Biol Cell 2009 20(1) 21-32 
[ PubMed ID = 18923146 ] [ RRC reference ]

Fritz JA, Behm CA.
CUTI-1: A novel tetraspan protein involved in C. elegans CUTicle formation and epithelial integrity.
PLoS One 2009 4(4) e5117 
[ PubMed ID = 19357781 ] [ RRC reference ]