分離済み変異体

tm2243

Allele Nametm2243
BalanceNot Required
OutCrossNot Accepted
Sequence NameF14F4.1
Gene Namentr-2
Worm BaseAllele Name tm2243
Gene Name ntr-2
Sequence F14F4.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Bargmann: viable, fertile, normal thermotaxis. Dr. P. Sengupta: normal dye filling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2875/2876-GTA-4015/4016 (1140 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(2554..2687,2740..2901,2952..3047, 3095..3189, 3234..3318, 3403..3524, 3574..3701, 4982..5101, 6154..6228,6276..6455))
Map position21.57
Balancer
Map position of balancer
Sequence of primersExtFwd:GACCGGTTACTGAAAGCGGT,IntFwd:TGAAAGCGGTGTAAGCATGA,ExtRev:TACCTGCAATCGCGCTCCAT,IntRev:GTGACCCTGATTTCGGTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chai CM, Park H, Sternberg PW.
Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision.
Curr Biol 2022 32(15) 3365-3373.e6 
[ PubMed ID = 35679871 ] [ RRC reference ]

Scott E, Hudson A, Feist E, Calahorro F, Dillon J, de Freitas R, Wand M, Schoofs L, O'Connor V, Holden-Dye L.
An oxytocin-dependent social interaction between larvae and adult C. elegans.
Sci Rep 2017 7(1) 10122 
[ PubMed ID = 28860630 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Garrison JL, Macosko EZ, Bernstein S, Pokala N, Albrecht DR, Bargmann CI.
Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior.
Science 2012 338(6106) 540-3 
[ PubMed ID = 23112335 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J Neurosci 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]