| Allele Name | tm2235 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y110A2AL.13 |
| Gene Name | pinn-1 |
| Worm Base | Allele Name |
tm2235
|
| Gene Name |
pinn-1
|
| Sequence |
Y110A2AL.13
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. K.F. O'Connell: normal hatching, locomotion and body shape. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 52164/52165-52528/52529 (364 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(49933..50055, 50799..50905, 52115..52262, 52371..52444, 52492..52546)) |
| Map position | -9.56 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:ATACGGGCCAATTTTCCAGA,IntRev:GATGTCCGATAATTCGCTGC,IntFwd:CCCTCAATGTTCGACGCATC,ExtFwd:GGCGGTTACAGTACCCCAAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Stubbe FX, Ponsard P, Steiner FA, Hermand D. SSUP-72/PINN-1 coordinates RNA-polymerase II 3' pausing and developmental gene expression in C. elegans. Nat Commun 2025 16(1) 2624
[ PubMed ID = 40097442 ]
[ RRC reference ]
|
Salzberg Y, Pechuk V, Gat A, Setty H, Sela S, Oren-Suissa M. Synaptic Protein Degradation Controls Sexually Dimorphic Circuits through Regulation of DCC/UNC-40. Curr Biol 2020 30(21) 4128-4141.e5
[ PubMed ID = 32857970 ]
[ RRC reference ]
|
Chen F, Chisholm AD, Jin Y. Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development. Development 2017 144(4) 698-707
[ PubMed ID = 28087624 ]
[ RRC reference ]
|
Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD. DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair. Elife 2016 5
[ PubMed ID = 27661253 ]
[ RRC reference ]
|
Del Rosario JS, Feldmann KG, Ahmed T, Amjad U, Ko B, An J, Mahmud T, Salama M, Mei S, Asemota D, Mano I. Death Associated Protein Kinase (DAPK) -mediated neurodegenerative mechanisms in nematode excitotoxicity. BMC Neurosci 2015 16 25
[ PubMed ID = 25899010 ]
[ RRC reference ]
|
|