分離済み変異体

tm2214

Allele Nametm2214
BalanceCompleted
OutCrossNot Accepted
Sequence NameC44B7.3
Gene Nameaff-1
Worm BaseAllele Name tm2214 (x1)
Gene Name aff-1
Sequence C44B7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4362/4363-5356/5357 (994 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(2536..2697, 2744..2834, 2904..3105, 3556..3634, 3683..3903, 3952..4051, 4107..4240, 4286..4406, 4456..4608, 4690..4892, 4940..5093, 5350..5454))
Map position0.13
BalancertmC6[tmIs1189]
Map position of balancer
Sequence of primersExtRev:GCCGCTTTTCGATGCGTGAT,IntFwd:GTTCCTTTGACGCCCTGAAT,ExtFwd:CGCGATGAGCTTTCGATCGT,IntRev:CTCGCAATCAATTAGCAGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079 
[ PubMed ID = 39870634 ] [ RRC reference ]

Singh P, Selvarasu K, Ghosh-Roy A.
Optimization of RNAi efficiency in PVD neuron of C. elegans.
PLoS One 2024 19(3) e0298766 
[ PubMed ID = 38498505 ] [ RRC reference ]

Heinze SD, Berger S, Engleitner S, Daube M, Hajnal A.
Prolonging somatic cell proliferation through constitutive hox gene expression in C. elegans.
Nat Commun 2023 14(1) 6850 
[ PubMed ID = 37891160 ] [ RRC reference ]

Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Soulavie F, Hall DH, Sundaram MV.
The AFF-1 exoplasmic fusogen is required for endocytic scission and seamless tube elongation.
Nat Commun 2018 9(1) 1741 
[ PubMed ID = 29717108 ] [ RRC reference ]

Ghose P, Rashid A, Insley P, Trivedi M, Shah P, Singhal A, Lu Y, Bao Z, Shaham S.
EFF-1 fusogen promotes phagosome sealing during cell process clearance in Caenorhabditis elegans.
Nat Cell Biol 2018 20(4) 393-399 
[ PubMed ID = 29556089 ] [ RRC reference ]

Oren-Suissa M, Gattegno T, Kravtsov V, Podbilewicz B.
Extrinsic Repair of Injured Dendrites as a Paradigm for Regeneration by Fusion in Caenorhabditis elegans.
Genetics 2017 206(1) 215-230 
[ PubMed ID = 28283540 ] [ RRC reference ]

Chiorazzi M, Rui L, Yang Y, Ceribelli M, Tishbi N, Maurer CW, Ranuncolo SM, Zhao H, Xu W, Chan WC, Jaffe ES, Gascoyne RD, Campo E, Rosenwald A, Ott G, Delabie J, Rimsza LM, Shaham S, Staudt LM.
Related F-box proteins control cell death in Caenorhabditis elegans and human lymphoma.
Proc Natl Acad Sci U S A 2013 110(10) 3943-8 
[ PubMed ID = 23431138 ] [ RRC reference ]

Rasmussen JP, Feldman JL, Reddy SS, Priess JR.
Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans.
PLoS Genet 2013 9(9) e1003772 
[ PubMed ID = 24039608 ] [ RRC reference ]

Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J Neurosci 2010 30(9) 3175-83 
[ PubMed ID = 20203177 ] [ RRC reference ]

Stone CE, Hall DH, Sundaram MV.
Lipocalin signaling controls unicellular tube development in the Caenorhabditis elegans excretory system.
Dev Biol 2009 329(2) 201-11 
[ PubMed ID = 19269285 ] [ RRC reference ]

Rasmussen JP, English K, Tenlen JR, Priess JR.
Notch signaling and morphogenesis of single-cell tubes in the C. elegans digestive tract.
Dev Cell 2008 14(4) 559-69 
[ PubMed ID = 18410731 ] [ RRC reference ]

Sapir A, Choi J, Leikina E, Avinoam O, Valansi C, Chernomordik LV, Newman AP, Podbilewicz B.
AFF-1, a FOS-1-regulated fusogen, mediates fusion of the anchor cell in C. elegans.
Dev Cell 2007 12(5) 683-98 
[ PubMed ID = 17488621 ] [ RRC reference ]