Allele Name | tm2211 |
Allele Type | バランス済 |
Sequence Name | Y48G1C.4 |
Gene Name | pgs-1 |
Worm Base | Allele Name |
tm2211
|
Gene Name |
pgs-1
|
Sequence |
Y48G1C.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. M. Sundaram: sterile. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 5370/5371-6013/6014 (643 bp deletion) |
Chromosome | I |
Putative gene structure | join(2432..2527, 3326..3541, 4794..4921, 4977..5083, 5777..5848, 5902..6206, 6455..6871) |
Map position | -20.87 |
Balancer | hT2 bli-4(e937) let-? qIs48] |
Map position of balancer | |
Sequence of primers | IntFwd:CAGCGAGCCGACGAGATTAT,ExtFwd:TTCCACACACCGGAGCTTAG,IntRev:GAACCGATCGATAACCGTAA,ExtRev:GTGCAGCCATGTCAAGTATC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Sakamoto T, Inoue T, Otomo Y, Yokomori N, Ohno M, Arai H, Nakagawa Y. Deficiency of cardiolipin synthase causes abnormal mitochondrial function and morphology in germ cells of Caenorhabditis elegans. J Biol Chem 2012 287(7) 4590-601
[ PubMed ID = 22174409 ]
[ RRC reference ]
|
|