分離済み変異体

tm2190

Allele Nametm2190
BalanceNot Required
OutCrossNot Accepted
Sequence NameY69A2AR.30
Gene Namemdf-2
Worm BaseAllele Name tm2190
Gene Name mdf-2
Sequence Y69A2AR.30
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 156408/156409-157272/157273 (864 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(152634..152705, 153629..153770, 155719..155781, 156646..156763, 156828..156974, 157025..157094))
Map position-6.81
Balancer
Map position of balancer
Sequence of primersExtRev:GCCATACCAGCGACCTGTCT,IntFwd:AGCACCATCACACCACCTGA,ExtFwd:CACGTCTGTCGCCTAGATAT,IntRev:CGACCTGTCTGGCCTTCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Devigne A, Bhalla N.
Mad1's ability to interact with Mad2 is essential to regulate and monitor meiotic synapsis in C. elegans.
PLoS Genet 2021 17(11) e1009598 
[ PubMed ID = 34762652 ] [ RRC reference ]

Défachelles L, Russo AE, Nelson CR, Bhalla N.
The conserved AAA-ATPase PCH-2 TRIP13 regulates spindle checkpoint strength.
Mol Biol Cell 2020 31(20) 2219-2233 
[ PubMed ID = 32697629 ] [ RRC reference ]

Gerhold AR, Poupart V, Labbé JC, Maddox PS.
Spindle assembly checkpoint strength is linked to cell fate in the Caenorhabditis elegans embryo.
Mol Biol Cell 2018 29(12) 1435-1448 
[ PubMed ID = 29688794 ] [ RRC reference ]

Bohr T, Nelson CR, Klee E, Bhalla N.
Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans.
J Cell Biol 2015 211(2) 233-42 
[ PubMed ID = 26483555 ] [ RRC reference ]

Gerhold AR, Ryan J, Vallée-Trudeau JN, Dorn JF, Labbé JC, Maddox PS.
Investigating the regulation of stem and progenitor cell mitotic progression by in situ imaging.
Curr Biol 2015 25(9) 1123-34 
[ PubMed ID = 25819563 ] [ RRC reference ]

Tarailo-Graovac M, Wang J, Chu JS, Tu D, Baillie DL, Chen N.
Spindle assembly checkpoint genes reveal distinct as well as overlapping expression that implicates MDF-2/Mad2 in postembryonic seam cell proliferation in Caenorhabditis elegans.
BMC Cell Biol 2010 11 71 
[ PubMed ID = 20858267 ] [ RRC reference ]

Essex A, Dammermann A, Lewellyn L, Oegema K, Desai A.
Systematic analysis in Caenorhabditis elegans reveals that the spindle checkpoint is composed of two largely independent branches.
Mol Biol Cell 2009 20(4) 1252-67 
[ PubMed ID = 19109417 ] [ RRC reference ]

Watanabe S, Yamamoto TG, Kitagawa R.
Spindle assembly checkpoint gene mdf-1 regulates germ cell proliferation in response to nutrition signals in C. elegans.
EMBO J 2008 27(7) 1085-96 
[ PubMed ID = 18309291 ] [ RRC reference ]