| Allele Name | tm2188 |
| Allele Type | バランス済 |
| Sequence Name | M03C11.2 |
| Gene Name | chl-1 |
| Worm Base | Allele Name |
tm2188
|
| Gene Name |
chl-1
|
| Sequence |
M03C11.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 10729/10730-GATCCAAGGTATGTTAAAATCG-11573/11574 (844 bp deletion + 22 bp insertion) |
| Chromosome | III |
| Putative gene structure | complement(join(9937..10197, 10671..10892, 11050..11455, 11862..12073, 12381..12691, 13426..14005, 14799..14912, 15378..15480, 15542..15879)) |
| Map position | 2.48 |
| Balancer | hT2 bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGCTGACCAAGGATTCCTGT,ExtRev:CAGGTTCCCTCTACTCTGCT,IntFwd:CCTTCATCCGTTCCCTCAAC,IntRev:TAACCCTCGCACTGCGTCTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Chung G, O'Neil NJ, Rose AM.
CHL-1 provides an essential function affecting cell proliferation and chromosome stability in Caenorhabditis elegans.
DNA Repair (Amst) 2011 10(11) 1174-82
[ PubMed ID = 21968058 ]
[ RRC reference ]
|
Gilchrist EJ, O'Neil NJ, Rose AM, Zetka MC, Haughn GW.
TILLING is an effective reverse genetics technique for Caenorhabditis elegans.
BMC Genomics 2006 7 262
[ PubMed ID = 17049087 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.