分離済み変異体

tm2181

Allele Nametm2181
BalanceCompleted
OutCrossNot Accepted
Sequence NameT04A8.15
Gene Namehim-18
Worm BaseAllele Name tm2181 (x1)
Gene Name him-18
Sequence T04A8.15
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M. Colaiacovo: PLoS Genetics, 5(11), e1000735 (2009)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36603/36604-36997/36998 (394 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(35138..35290, 35339..35616, 35709..36771, 36817..37150, 37198..37290, 37335..37455, 37507..37562, 37637..37695))
Map position-2.8
Balancer,qC1[nIs281]
Map position of balancer
Sequence of primersExtFwd:GATCTGACAAGCGGACGAAT,IntFwd:CGGACGAATTGTAGGTGTTC,ExtRev:TCGGTAATCCGTTCATCCTC,IntRev:GTAATCCGTTCATCCTCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horton HH, Divekar NS, Wignall SM.
Newfound features of meiotic chromosome organization that promote efficient congression and segregation in Caenorhabditis elegans oocytes.
Mol Biol Cell 2022 33(14) br25 
[ PubMed ID = 36222840 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716 
[ PubMed ID = 36176234 ] [ RRC reference ]

Zhang X, Tian S, Beese-Sims SE, Chen J, Shin N, Colaiácovo MP, Kim HM.
Histone demethylase AMX-1 is necessary for proper sensitivity to interstrand crosslink DNA damage.
PLoS Genet 2021 17(7) e1009715 
[ PubMed ID = 34329293 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Libuda DE, Ramadugu A, Tam A, Martinez-Perez E, Roelens B, Zawadzki KA, Yokoo R, Rosu S, Severson AF, Meyer BJ, Nabeshima K, Villeneuve AM.
DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.
Genetics 2014 198(1) 193-207 
[ PubMed ID = 25053665 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Saito TT, Mohideen F, Meyer K, Harper JW, Colaiácovo MP.
SLX-1 is required for maintaining genomic integrity and promoting meiotic noncrossovers in the Caenorhabditis elegans germline.
PLoS Genet 2012 8(8) e1002888 
[ PubMed ID = 22927825 ] [ RRC reference ]

Saito TT, Youds JL, Boulton SJ, Colaiácovo MP.
Caenorhabditis elegans HIM-18/SLX-4 interacts with SLX-1 and XPF-1 and maintains genomic integrity in the germline by processing recombination intermediates.
PLoS Genet 2009 5(11) e1000735 
[ PubMed ID = 19936019 ] [ RRC reference ]