| Allele Name | tm2167 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K09B11.1 |
| Gene Name | pik-1 |
| Worm Base | Allele Name |
tm2167
|
| Gene Name |
pik-1
|
| Sequence |
K09B11.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. Y-C. Wu: normal cell corpse number druing comma to 2-fold embryonic stage. Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3429/3430-4089/4090 (660 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(831..942, 1827..2012, 2065..2233, 3199..3574, 4945..5559) |
| Map position | 8.81 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGATACACTTCGTGTAGCAA,ExtRev:GATGTGCTGCCAATTCCTTA,ExtFwd:GACACGGCGGCCATTCTATT,IntRev:CGAATATGCCCGTTGACCAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Flynn SM, Chen C, Artan M, Barratt S, Crisp A, Nelson GM, Peak-Chew SY, Begum F, Skehel M, de Bono M. MALT-1 mediates IL-17 neural signaling to regulate C. elegans behavior, immunity and longevity. Nat Commun 2020 11(1) 2099
[ PubMed ID = 32350248 ]
[ RRC reference ]
|
Hodgkin J. Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration. J Dev Biol 2019 7(4)
[ PubMed ID = 31771156 ]
[ RRC reference ]
|
Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M. IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses. Nature 2017 542(7639) 43-48
[ PubMed ID = 28099418 ]
[ RRC reference ]
|
|