分離済み変異体

tm2166

Allele Nametm2166
BalanceNot Required
OutCrossNot Accepted
Sequence NameR03G5.5
Gene Namegpx-7
Worm BaseAllele Name tm2166
Gene Name gpx-7
Sequence R03G5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1744/1745-ACGTTGCAGC-2691/2692 (947 bp deletion + 10 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(1877..1949, 1996..2197, 2257..2408, 2464..2618))
Map position-1.2
Balancer
Map position of balancer
Sequence of primersIntFwd:ATAACAGCAGCGCCCAACAG,ExtFwd:GTACACTCGGACAAGTCATG,IntRev:CGATTATGTCGCCATAAACC,ExtRev:CTTGAGAATCACGCGCCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Inomata R, Saito R, Wang D, Shimazaki S.
Bacillus subtilis TO-A suppresses the age-related decline in locomotion in Caenorhabditis elegans.
Commun Biol 2025 8(1) 1492 
[ PubMed ID = 41125718 ] [ RRC reference ]

Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079 
[ PubMed ID = 39870634 ] [ RRC reference ]

Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC.
Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy.
PLoS Genet 2019 15(12) e1008526 
[ PubMed ID = 31834878 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS One 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42 
[ PubMed ID = 23086219 ] [ RRC reference ]