分離済み変異体

tm2156

Allele Nametm2156
BalanceNot Required
OutCrossNot Accepted
Sequence NameY39B6A.38
Gene Namereps-1
Worm BaseAllele Name tm2156
Gene Name reps-1
Sequence Y39B6A.38
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29720/29721-30499/30500 (780 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(28608..28928, 29372..29430, 29558..29776, 30646..30757, 30858..31273, 32207..32312))
Map position18.48
Balancer
Map position of balancer
Sequence of primersExtRev:GGACGCTGCTTTTCCGTTTA,IntFwd:AGAGGTGACGGTGTGATTCT,ExtFwd:CCCTTAACTTACCGGTAGAG,IntRev:GCCGATTCCAACGCGGATTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tsushima H, Malabarba MG, Confalonieri S, Senic-Matuglia F, Verhoef LG, Bartocci C, D'Ario G, Cocito A, Di Fiore PP, Salcini AE.
A snapshot of the physical and functional wiring of the Eps15 homology domain network in the nematode.
PLoS One 2013 8(2) e56383 
[ PubMed ID = 23424658 ] [ RRC reference ]

Wang W, Bouhours M, Gracheva EO, Liao EH, Xu K, Sengar AS, Xin X, Roder J, Boone C, Richmond JE, Zhen M, Egan SE.
ITSN-1 controls vesicle recycling at the neuromuscular junction and functions in parallel with DAB-1.
Traffic 2008 9(5) 742-54 
[ PubMed ID = 18298590 ] [ RRC reference ]