| Allele Name | tm2149 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y110A7A.16 |
| Gene Name | elpc-1 |
| Worm Base | Allele Name |
tm2149
|
| Gene Name |
elpc-1
|
| Sequence |
Y110A7A.16
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. A. Bystrom: PLoS Genetics 5, e1000561 (2009) |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 16391/16392-16666/16667 (275 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(13564..13668, 13924..14093, 14143..15228, 15378..16023, 16110..16565, 16622..16974, 17021..17309, 17360..17594, 17646..17857, 17916..17975, 18025..18110, 18158..18212)) |
| Map position | -0.4 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTCCACTTGAATCACGTGAT,IntFwd:ATGCACTTCGGTAGACTCGA,ExtRev:CGTTCCAGGTGCGGACGATT,IntRev:CGGACGATTTCGCAGTTCAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Meyer DH, Schumacher B. BiT age: A transcriptome-based aging clock near the theoretical limit of accuracy. Aging Cell 2021 20(3) e13320
[ PubMed ID = 33656257 ]
[ RRC reference ]
|
Fernandes De Abreu DA, Salinas-Giegé T, Drouard L, Remy JJ. Alanine tRNAs Translate Environment Into Behavior in Caenorhabditis elegans. Front Cell Dev Biol 2020 8 571359
[ PubMed ID = 33195203 ]
[ RRC reference ]
|
Kawamura K, Maruyama IN. Forward Genetic Screen for Caenorhabditis elegans Mutants with a Shortened Locomotor Healthspan. G3 (Bethesda) 2019 9(8) 2415-2423
[ PubMed ID = 31213517 ]
[ RRC reference ]
|
Nedialkova DD, Leidel SA. Optimization of Codon Translation Rates via tRNA Modifications Maintains Proteome Integrity. Cell 2015 161(7) 1606-18
[ PubMed ID = 26052047 ]
[ RRC reference ]
|
Chen C, Tuck S, Byström AS. Defects in tRNA modification associated with neurological and developmental dysfunctions in Caenorhabditis elegans elongator mutants. PLoS Genet 2009 5(7) e1000561
[ PubMed ID = 19593383 ]
[ RRC reference ]
|
|