分離済み変異体

tm2146

Allele Nametm2146
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G2A.35
Gene Nameser-6
Worm BaseAllele Name tm2146
Gene Name ser-6
Sequence Y54G2A.35
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: Cell Metab 7, 533 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 209546/209547-210211/210212 (665 bp deletion)
ChromosomeIV
Putative gene structurejoin(209902..210084, 210691..210854, 210912..211218, 212171..212388, 212516..212560, 213591..213879)
Map position-6.84
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGCAGGCATGTAGGTATCT,ExtFwd:GGTAGGCGCCCTAAAGATTC,IntRev:TGACCGAGTTACGGCCTGTT,ExtRev:ATCCGACATCGATGGAGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhao H, Shi G, Qin R, Sun Y, Guo W, Shi R, Peng M, Yang J, Zhao J, Liu Q, Xiao J, Zhang K, Liu Q, Yang W, Liu H.
Hungry for Knowledge: Octopamine Signaling Regulates Hunger-Enhanced Olfactory Learning.
Adv Sci (Weinh) 2026 13(12) e13842 
[ PubMed ID = 41392936 ] [ RRC reference ]

Yokosawa R, Noma K.
A Nuclear Hormone Receptor nhr-76 Induces Age-Dependent Chemotaxis Decline in C. elegans.
Aging Cell 2025 24(12) e70277 
[ PubMed ID = 41128441 ] [ RRC reference ]

Wu YC, Beets I, Fox BW, Fajardo Palomino D, Chen L, Liao CP, Vandewyer E, Lin LY, He CW, Chen LT, Lin CT, Schroeder FC, Pan CL.
Intercellular sphingolipid signaling mediates aversive learning in C. elegans.
Curr Biol 2025 35(10) 2323-2336.e9 
[ PubMed ID = 40252647 ] [ RRC reference ]

Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Tsai Y, Lin YC, Lee YH.
Octopamine-MAPK-SKN-1 signaling suppresses mating-induced oxidative stress in Caenorhabditis elegans gonads to protect fertility.
iScience 2023 26(3) 106162 
[ PubMed ID = 36876134 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Lin Y, Bao B, Yin H, Wang X, Feng A, Zhao L, Nie X, Yang N, Shi GP, Liu J.
Peripheral cathepsin L inhibition induces fat loss in C. elegans and mice through promoting central serotonin synthesis.
BMC Biol 2019 17(1) 93 
[ PubMed ID = 31771567 ] [ RRC reference ]

Liu H, Qin LW, Li R, Zhang C, Al-Sheikh U, Wu ZX.
Reciprocal modulation of 5-HT and octopamine regulates pumping via feedforward and feedback circuits in C. elegans.
Proc Natl Acad Sci U S A 2019 116(14) 7107-7112 
[ PubMed ID = 30872487 ] [ RRC reference ]

Bayer EA, Hobert O.
Past experience shapes sexually dimorphic neuronal wiring through monoaminergic signalling.
Nature 2018 561(7721) 117-121 
[ PubMed ID = 30150774 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Hoshikawa H, Uno M, Honjoh S, Nishida E.
Octopamine enhances oxidative stress resistance through the fasting-responsive transcription factor DAF-16/FOXO in C. elegans.
Genes Cells 2017 22(2) 210-219 
[ PubMed ID = 28105749 ] [ RRC reference ]

Tao J, Ma YC, Yang ZS, Zou CG, Zhang KQ.
Octopamine connects nutrient cues to lipid metabolism upon nutrient deprivation.
Sci Adv 2016 2(5) e1501372 
[ PubMed ID = 27386520 ] [ RRC reference ]

Nagashima T, Oami E, Kutsuna N, Ishiura S, Suo S.
Dopamine regulates body size in Caenorhabditis elegans.
Dev Biol 2016 412(1) 128-138 
[ PubMed ID = 26921458 ] [ RRC reference ]

Rangaraju S, Solis GM, Thompson RC, Gomez-Amaro RL, Kurian L, Encalada SE, Niculescu AB 3rd, Salomon DR, Petrascheck M.
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality.
Elife 2015 4 e08833 
[ PubMed ID = 26623667 ] [ RRC reference ]

Gomez-Amaro RL, Valentine ER, Carretero M, LeBoeuf SE, Rangaraju S, Broaddus CD, Solis GM, Williamson JR, Petrascheck M.
Measuring Food Intake and Nutrient Absorption in Caenorhabditis elegans.
Genetics 2015 200(2) 443-54 
[ PubMed ID = 25903497 ] [ RRC reference ]

Yoshida M, Oami E, Wang M, Ishiura S, Suo S.
Nonredundant function of two highly homologous octopamine receptors in food-deprivation-mediated signaling in Caenorhabditis elegans.
J Neurosci Res 2014 92(5) 671-8 
[ PubMed ID = 24446241 ] [ RRC reference ]

Noble T, Stieglitz J, Srinivasan S.
An integrated serotonin and octopamine neuronal circuit directs the release of an endocrine signal to control C. elegans body fat.
Cell Metab 2013 18(5) 672-84 
[ PubMed ID = 24120942 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc Natl Acad Sci U S A 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]