分離済み変異体

tm2143

Allele Name

tm2143

Allele Type

バランス済

Sequence Name

K11D9.1a

Gene Name

klp-7

Worm Base

Allele Name

tm2143

Gene Name

klp-7

Sequence

K11D9.1a

Phenotype

lethal or sterile. Dr. H. Sawa: embryonic lethal, slightly Unc, escapers are not Psa. Dr. B.J. Meyer: unable to outcross. Dr. O. Blacque: could not assess Dyf phenotype due to lethality.

Mutation site

10248/10249-11123/11124 (875 bp deletion)

Chromosome

III

Putative gene structure

join(7624..7792, 10035..10153, 10294..10510, 10559..11216, 11267..11728, 11779..12090, 12138..12444)

Map position

5.4

Balancer

unc-119 (ed3) III

Map position of balancer

5.59

Sequence of primers

ExtFwd:CTTGTCGTCGGGATGCATGT,IntFwd:CGCATCCACGGTGCCGTAAT,ExtRev:TCACTGTCCTGGACTTCTCA,IntRev:CTCACCGATGAAGCTGTCTC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Puri D, Ponniah K, Biswas K, Basu A, Dey S, Lundquist EA, Ghosh-Roy A.
Wnt signaling establishes the microtubule polarity in neurons through regulation of Kinesin-13.
J Cell Biol 2021 220(9)
[ PubMed ID = 34137792 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7
[ PubMed ID = 33857430 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050
[ PubMed ID = 32103012 ] [ RRC reference ]

Bondaz A, Cirillo L, Meraldi P, Gotta M.
Cell polarity-dependent centrosome separation in the C. elegans embryo.
J Cell Biol 2019 218(12) 4112-4126
[ PubMed ID = 31645459 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5
[ PubMed ID = 27661253 ] [ RRC reference ]

van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733
[ PubMed ID = 26657059 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460
[ PubMed ID = 27764672 ] [ RRC reference ]

Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M.
Distinct effects of tubulin isotype mutations on neurite growth in Caenorhabditis elegans.
Mol Biol Cell 2017 28(21) 2786-2801
[ PubMed ID = 28835377 ] [ RRC reference ]

Gigant E, Stefanutti M, Laband K, Gluszek-Kustusz A, Edwards F, Lacroix B, Maton G, Canman JC, Welburn JPI, Dumont J.
Inhibition of ectopic microtubule assembly by the kinesin-13 KLP-7 prevents chromosome segregation and cytokinesis defects in oocytes.
Development 2017 144(9) 1674-1686
[ PubMed ID = 28289130 ] [ RRC reference ]

Sugioka K, Mizumoto K, Sawa H.
Wnt regulates spindle asymmetry to generate asymmetric nuclear β-catenin in C. elegans.
Cell 2011 146(6) 942-54
[ PubMed ID = 21925317 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83
[ PubMed ID = 25437544 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr Biol 2015 25(12) 1594-605
[ PubMed ID = 26051896 ] [ RRC reference ]

Han X, Adames K, Sykes EM, Srayko M.
The KLP-7 Residue S546 Is a Putative Aurora Kinase Site Required for Microtubule Regulation at the Centrosome in C. elegans.
PLoS One 2015 10(7) e0132593
[ PubMed ID = 26168236 ] [ RRC reference ]

Connolly AA, Sugioka K, Chuang CH, Lowry JB, Bowerman B.
KLP-7 acts through the Ndc80 complex to limit pole number in C. elegans oocyte meiotic spindle assembly.
J Cell Biol 2015 210(6) 917-32
[ PubMed ID = 26370499 ] [ RRC reference ]