分離済み変異体

tm2134

Allele Name

tm2134

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y55B1AL.3

Gene Name

helq-1

Worm Base

Allele Name

tm2134

Gene Name

helq-1

Sequence

Y55B1AL.3

Phenotype

homozygous viable

Mutation site

10827/10828-11173/11174 (346 bp deletion)

Chromosome

III

Putative gene structure

complement(join(3949..4119, 4167..4328, 5429..5695, 5755..5990, 6621..7095, 9995..10169, 10219..10355, 10405..10497, 10596..10964, 11437..11615, 11672..12103, 13124..13199))

Map position

-26.7

Balancer

Map position of balancer

Sequence of primers

IntRev:TCTCCGTTACATCACCACCT,ExtRev:GATTACGAACGCCTCGAACA,IntFwd:TCAGCACAGCATCCATCCGT,ExtFwd:CCGAATGATGATAGGCCACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Verschuren J, van Schendel R, van Bostelen I, Verkennis AEE, Knipscheer P, Tijsterman M.
FAN1-mediated translesion synthesis and POLQ/HELQ-mediated end joining generate interstrand crosslink-induced mutations.
Nat Commun 2025 16(1) 2495
[ PubMed ID = 40082407 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716
[ PubMed ID = 36176234 ] [ RRC reference ]

Kamp JA, Lemmens BBLG, Romeijn RJ, Changoer SC, van Schendel R, Tijsterman M.
Helicase Q promotes homology-driven DNA double-strand break repair and prevents tandem duplications.
Nat Commun 2021 12(1) 7126
[ PubMed ID = 34880204 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621
[ PubMed ID = 32414869 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856
[ PubMed ID = 30242011 ] [ RRC reference ]

McClendon TB, Sullivan MR, Bernstein KA, Yanowitz JL.
Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans.
Genetics 2016 203(1) 133-45
[ PubMed ID = 26936927 ] [ RRC reference ]

Taylor MRG, Špírek M, Chaurasiya KR, Ward JD, Carzaniga R, Yu X, Egelman EH, Collinson LM, Rueda D, Krejci L, Boulton SJ.
Rad51 Paralogs Remodel Pre-synaptic Rad51 Filaments to Stimulate Homologous Recombination.
Cell 2015 162(2) 271-286
[ PubMed ID = 26186187 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9
[ PubMed ID = 24768858 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol Cell 2010 37(2) 259-72
[ PubMed ID = 20122407 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst) 2008 7(6) 941-50
[ PubMed ID = 18472307 ] [ RRC reference ]