| Allele Name | tm2123 |
| Balance | Request Available |
| OutCross | Not Accepted |
| Sequence Name | Y80D3A.3 |
| Gene Name | ceh-51 |
| Worm Base | Allele Name |
tm2123
|
| Gene Name |
ceh-51
|
| Sequence |
Y80D3A.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. M. Maduro: Development 136, 2735 (2009). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 18370/18371-TNCCGGTTCTAGTA-19980/19981 (1610 bp deletion + 14 bp insertion) |
| Chromosome | V |
| Putative gene structure | join(18453..18706, 19777..20227) |
| Map position | 18.26 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GATCTGCTCGGGCGAAAGTC,IntFwd:GCACTATATGCCTAGATTCG,IntRev:CCGTCGCTCGTCAACCTTTA,ExtFwd:AGGGAGCACTATATGCCTAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Rasmussen JP, Feldman JL, Reddy SS, Priess JR.
Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans.
PLoS Genet 2013 9(9) e1003772
[ PubMed ID = 24039608 ]
[ RRC reference ]
|
Harrell JR, Goldstein B.
Internalization of multiple cells during C. elegans gastrulation depends on common cytoskeletal mechanisms but different cell polarity and cell fate regulators.
Dev Biol 2011 350(1) 1-12
[ PubMed ID = 20875815 ]
[ RRC reference ]
|
Owraghi M, Broitman-Maduro G, Luu T, Roberson H, Maduro MF.
Roles of the Wnt effector POP-1/TCF in the C. elegans endomesoderm specification gene network.
Dev Biol 2010 340(2) 209-21
[ PubMed ID = 19818340 ]
[ RRC reference ]
|
Broitman-Maduro G, Owraghi M, Hung WW, Kuntz S, Sternberg PW, Maduro MF.
The NK-2 class homeodomain factor CEH-51 and the T-box factor TBX-35 have overlapping function in C. elegans mesoderm development.
Development 2009 136(16) 2735-46
[ PubMed ID = 19605496 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.