| Allele Name | tm2114 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F56E3.3 |
| Gene Name | klp-4 |
| Worm Base | Allele Name |
tm2114
|
| Gene Name |
klp-4
|
| Sequence |
F56E3.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. P. Sengupta: normal dye filling. Dr. C. Bargmann: locomotion OK, normal GFP::UNC-2 localization. Dr. O. Blacque: dye-filling normal. Dr. H. Sawa: 0% Psa. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5626/5627-6373/6374 (747 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(137..165, 250..388, 441..503, 552..625, 1505..1565, 1639..1806, 1849..2019, 2064..2237, 2286..2568, 2618..3270, 3319..3618, 3669..3852, 3903..4223, 4281..4495, 4569..4927, 4981..5080, 5129..5734, 5842..5908, 5980..6227, 6281..6368, 6422..6531, 6608..6842, 6899..6971, 7031..7097)) |
| Map position | -11.45 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GCTATTCGTGTACGCCCGTT,IntRev:GCCCGTTTAACAAAAGAGGT,ExtFwd:GACCTCGGAGGACAATACTA,IntFwd:GTCCAGAGTCTCTACTTGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Heinze SD, Berger S, Engleitner S, Daube M, Hajnal A.
Prolonging somatic cell proliferation through constitutive hox gene expression in C. elegans.
Nat Commun 2023 14(1) 6850
[ PubMed ID = 37891160 ]
[ RRC reference ]
|
Magaletta ME, Perkins KJ, Deuchler CP, Pieczynski JN.
The Kinesin-3 motor, KLP-4, mediates axonal organization and cholinergic signaling in Caenorhabditis elegans.
FASEB Bioadv 2019 1(7) 450-460
[ PubMed ID = 32123843 ]
[ RRC reference ]
|
Moss BJ, Park L, Dahlberg CL, Juo P.
The CaM Kinase CMK-1 Mediates a Negative Feedback Mechanism Coupling the C. elegans Glutamate Receptor GLR-1 with Its Own Transcription.
PLoS Genet 2016 12(7) e1006180
[ PubMed ID = 27462879 ]
[ RRC reference ]
|
Monteiro MI, Ahlawat S, Kowalski JR, Malkin E, Koushika SP, Juo P.
The kinesin-3 family motor KLP-4 regulates anterograde trafficking of GLR-1 glutamate receptors in the ventral nerve cord of Caenorhabditis elegans.
Mol Biol Cell 2012 23(18) 3647-62
[ PubMed ID = 22855524 ]
[ RRC reference ]
|
Sugioka K, Mizumoto K, Sawa H.
Wnt regulates spindle asymmetry to generate asymmetric nuclear β-catenin in C. elegans.
Cell 2011 146(6) 942-54
[ PubMed ID = 21925317 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.