分離済み変異体

tm2104

Allele Nametm2104
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G2A.35
Gene Nameser-6
Worm BaseAllele Name tm2104
Gene Name ser-6
Sequence Y54G2A.35
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 209906/209907-AGGCAACCGTACAGCA-210581/210582 (675 bp deletion + 16 bp insertion)
ChromosomeIV
Putative gene structurejoin(209902..210084, 210691..210854, 210912..211218, 212171..212388, 212516..212560, 213591..213879)
Map position-6.84
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGCAGGCATGTAGGTATCT,ExtFwd:GGTAGGCGCCCTAAAGATTC,IntRev:TGACCGAGTTACGGCCTGTT,ExtRev:ATCCGACATCGATGGAGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Liao CP, Chiang YC, Tam WH, Chen YJ, Chou SH, Pan CL.
Neurophysiological basis of stress-induced aversive memory in the nematode Caenorhabditis elegans.
Curr Biol 2022 32(24) 5309-5322.e6 
[ PubMed ID = 36455561 ] [ RRC reference ]

Suo S, Harada K, Matsuda S, Kyo K, Wang M, Maruyama K, Awaji T, Tsuboi T.
Sexually Dimorphic Regulation of Behavioral States by Dopamine in Caenorhabditis elegans.
J Neurosci 2019 39(24) 4668-4683 
[ PubMed ID = 30988167 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Yoshida M, Oami E, Wang M, Ishiura S, Suo S.
Nonredundant function of two highly homologous octopamine receptors in food-deprivation-mediated signaling in Caenorhabditis elegans.
J Neurosci Res 2014 92(5) 671-8 
[ PubMed ID = 24446241 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc Natl Acad Sci U S A 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]