分離済み変異体

tm2095

Allele Nametm2095
BalanceNot Required
OutCrossNot Accepted
Sequence NameK09A9.2
Gene Namerab-14
Worm BaseAllele Name tm2095
Gene Name rab-14
Sequence K09A9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. S. Eimer: normal levamisole receptor trafficking.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28564/28565-29266/29267 (702 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(27534..27696, 27760..27878, 28371..28615, 28762..28867))
Map position22.93
Balancer
Map position of balancer
Sequence of primersIntRev:ACGTGCGCATTCACTCGTCA,ExtRev:GGCTCAACACCAATGACAGA,IntFwd:GCTGCACGTGGCAAGTTCTG,ExtFwd:ATGGGTGACAAGCTCTCACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yoshida K, Suehiro Y, Dejima K, Yoshina S, Mitani S.
Distinct pathways for export of silencing RNA in Caenorhabditis elegans systemic RNAi.
iScience 2023 26(10) 108067 
[ PubMed ID = 37854694 ] [ RRC reference ]

Yin J, Huang Y, Guo P, Hu S, Yoshina S, Xuan N, Gan Q, Mitani S, Yang C, Wang X.
GOP-1 promotes apoptotic cell degradation by activating the small GTPase Rab2 in C. elegans.
J Cell Biol 2017 216(6) 1775-1794 
[ PubMed ID = 28424218 ] [ RRC reference ]

Huang J, Wang H, Chen Y, Wang X, Zhang H.
Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance.
Development 2012 139(24) 4613-22 
[ PubMed ID = 23172915 ] [ RRC reference ]

Sasidharan N, Sumakovic M, Hannemann M, Hegermann J, Liewald JF, Olendrowitz C, Koenig S, Grant BD, Rizzoli SO, Gottschalk A, Eimer S.
RAB-5 and RAB-10 cooperate to regulate neuropeptide release in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2012 109(46) 18944-9 
[ PubMed ID = 23100538 ] [ RRC reference ]

Guo P, Hu T, Zhang J, Jiang S, Wang X.
Sequential action of Caenorhabditis elegans Rab GTPases regulates phagolysosome formation during apoptotic cell degradation.
Proc Natl Acad Sci U S A 2010 107(42) 18016-21 
[ PubMed ID = 20921409 ] [ RRC reference ]