分離済み変異体

tm2092

Allele Nametm2092
BalanceNot Required
OutCrossNot Accepted
Sequence NameY46E12BL.1
Gene Nametig-3
Worm BaseAllele Name tm2092
Gene Name tig-3
Sequence Y46E12BL.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29269/29270-29972/29973 (703 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(26739..26980, 29347..29515, 29922..30193, 36026..36107))
Map position24.67
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTGTACTCCTCTCGCGTAA,IntFwd:CCGAGAGGAGTACACGGTTG,ExtRev:TTGATCGCATAGGGATACTG,IntRev:GCAACACAAATCAGCCGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ciccarelli EJ, Wing Z, Bendelstein M, Johal RK, Singh G, Monas A, Savage-Dunn C.
TGF-β ligand cross-subfamily interactions in the response of Caenorhabditis elegans to a bacterial pathogen.
PLoS Genet 2024 20(6) e1011324 
[ PubMed ID = 38875298 ] [ RRC reference ]

Ciccarelli EJ, Wing Z, Bendelstein M, Johal RK, Singh G, Monas A, Savage-Dunn C.
TGF-β Ligand Cross-Subfamily Interactions in the Response of Caenorhabditis elegans to Bacterial Pathogens.
bioRxiv 2023   
[ PubMed ID = 37215035 ] [ RRC reference ]

Baltaci O, Pedersen ME, Sherry T, Handley A, Snieckute G, Cao W, Haas M, Archer S, Pocock R.
Atypical TGF-β signaling controls neuronal guidance in Caenorhabditis elegans.
iScience 2022 25(2) 103791 
[ PubMed ID = 35146399 ] [ RRC reference ]