分離済み変異体

tm2056

Allele Nametm2056
BalanceNot Required
OutCrossNot Accepted
Sequence NameF09E10.8
Gene Nametoca-1
Worm BaseAllele Name tm2056
Gene Name toca-1
Sequence F09E10.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Oegema: wt dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25101/25102-25873/25874 (772 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(24644..24713, 24843..25000, 25737..26353, 27287..27597, 28200..28484, 29314..29429, 34938..34970))
Map position-17.93
Balancer
Map position of balancer
Sequence of primersExtRev:ATGTGATACGCAATAGCGCT,IntRev:AGCGCTCAACTGCGCTCAGT,ExtFwd:ATGGGTGGCGGCTCAGACTT,IntFwd:GAGCTGGGCACGAAACCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Raduwan H, Sasidharan S, Burgos LC, Wallace AG, Soto MC.
RhoGAP RGA-8 supports morphogenesis in C. elegans by polarizing epithelia.
Biol Open 2020 9(11)  
[ PubMed ID = 33243762 ] [ RRC reference ]

Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd.
C. elegans neurons have functional dendritic spines.
Elife 2019 8  
[ PubMed ID = 31584430 ] [ RRC reference ]

Bone CR, Chang YT, Cain NE, Murphy SP, Starr DA.
Nuclei migrate through constricted spaces using microtubule motors and actin networks in C. elegans hypodermal cells.
Development 2016 143(22) 4193-4202 
[ PubMed ID = 27697906 ] [ RRC reference ]

Bai Z, Grant BD.
A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling.
Proc Natl Acad Sci U S A 2015 112(12) E1443-52 
[ PubMed ID = 25775511 ] [ RRC reference ]

Chang YT, Dranow D, Kuhn J, Meyerzon M, Ngo M, Ratner D, Warltier K, Starr DA.
toca-1 is in a novel pathway that functions in parallel with a SUN-KASH nuclear envelope bridge to move nuclei in Caenorhabditis elegans.
Genetics 2013 193(1) 187-200 
[ PubMed ID = 23150597 ] [ RRC reference ]

Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet 2009 5(10) e1000675 
[ PubMed ID = 19798448 ] [ RRC reference ]