分離済み変異体

tm2051

Allele Nametm2051
Allele Type通常株
Sequence NameF41G3.12
Gene Nameagr-1
Worm BaseAllele Name tm2051
Gene Name agr-1
Sequence F41G3.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y-C. Wu: no hyperactive no locomotion defect.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22164/22165-22587/22588 (423 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(20958..21219, 21763..21943, 22271..22329, 22449..22515, 27393..27667, 27717..27834, 27880..28008, 28055..28256, 28307..28363, 28939..29031, 29082..29173, 29224..29329, 29372..29437, 29730..29961, 30025..30172, 30218..30402, 30442..30640, 30786..30894, 30944..31062, 31198..31425, 31473..31685, 31732..31822, 31872..32082, 32129..32258, 32314..32556, 34249..34458, 34513..34567, 34614..34706, 34750..34842, 34889..35074))
Map position0.09
Balancer
Map position of balancer
Sequence of primersExtFwd:CACGTCTCCTGGTGAAGCGA,IntFwd:TGGTGAAGCGACGACGTGAA,ExtRev:GCTGTGAGACTAACTTGGGA,IntRev:AGCTCTTCTCTGCCTCCCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Attreed M, Desbois M, van Kuppevelt TH, Bülow HE.
Direct visualization of specifically modified extracellular glycans in living animals.
Nat Methods 2012 9(5) 477-9 
[ PubMed ID = 22466794 ] [ RRC reference ]

Dejima K, Kang S, Mitani S, Cosman PC, Chisholm AD.
Syndecan defines precise spindle orientation by modulating Wnt signaling in C. elegans.
Development 2014 141(22) 4354-65 
[ PubMed ID = 25344071 ] [ RRC reference ]

Blanchette CR, Perrat PN, Thackeray A, Bénard CY.
Glypican Is a Modulator of Netrin-Mediated Axon Guidance.
PLoS Biol 2015 13(7) e1002183 
[ PubMed ID = 26148345 ] [ RRC reference ]

Hrus A, Lau G, Hutter H, Schenk S, Ferralli J, Brown-Luedi M, Chiquet-Ehrismann R, Canevascini S.
C. elegans agrin is expressed in pharynx, IL1 neurons and distal tip cells and does not genetically interact with genes involved in synaptogenesis or muscle function.
PLoS One 2007 2(8) e731 
[ PubMed ID = 17710131 ] [ RRC reference ]