分離済み変異体

tm2044

Allele Nametm2044
BalanceNot Required
OutCrossNot Accepted
Sequence NameT14F9.5
Gene Namelin-32
Worm BaseAllele Name tm2044
Gene Name lin-32
Sequence T14F9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. D. Portman: strong ray-missing phenotype. Dr. O. Hobert: Nat. Meth.5, 869 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24537/24538-TCTTAC-25636/25637 (1099 bp deletion + 6 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(24191..24337, 24722..24860, 24926..25068))
Map position-16.75
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGAGCATTCCTACTATTG,ExtFwd:TGTGTCGCCCGTTATCTTGA,IntFwd:TCTACCTACCGTAGACCCAG,ExtRev:TAGCCAATGCGCGAGCATTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hori S, Mitani S.
An atonal homolog, lin-32, regulates hypodermal morphogenesis in Caenorhabditis elegans.
MicroPubl Biol 2023 2023  
[ PubMed ID = 36873297 ] [ RRC reference ]

Hori S, Mitani S.
The transcription factor unc-130/FOXD3/4 contributes to the biphasic calcium response required to optimize avoidance behavior.
Sci Rep 2022 12(1) 1907 
[ PubMed ID = 35115609 ] [ RRC reference ]

Zhang A, Noma K, Yan D.
Regulation of Gliogenesis by lin-32/Atoh1 in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(9) 3271-3278 
[ PubMed ID = 32665354 ] [ RRC reference ]

Hori S, Oda S, Suehiro Y, Iino Y, Mitani S.
OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses.
PLoS Genet 2018 14(6) e1007477 
[ PubMed ID = 29939997 ] [ RRC reference ]

Miller RM, Portman DS.
The Wnt/beta-catenin asymmetry pathway patterns the atonal ortholog lin-32 to diversify cell fate in a Caenorhabditis elegans sensory lineage.
J Neurosci 2011 31(37) 13281-91 
[ PubMed ID = 21917811 ] [ RRC reference ]

Doitsidou M, Flames N, Lee AC, Boyanov A, Hobert O.
Automated screening for mutants affecting dopaminergic-neuron specification in C. elegans.
Nat Methods 2008 5(10) 869-72 
[ PubMed ID = 18758453 ] [ RRC reference ]