分離済み変異体

tm2024

Allele Nametm2024
BalanceNot Required
OutCrossNot Accepted
Sequence NameC11E4.1
Gene Namegpx-5
Worm BaseAllele Name tm2024
Gene Name gpx-5
Sequence C11E4.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1490/1491-TTTTATGATTTCAATTCAGTCTATTTTTTCTTTAATATTCAACTCACTTTAAAAAAAAATCTGGTTCTAATTTTTTTTCAAAACAATTGTGGTTGATT-2242/2243 (752 bp deletion + 98 bp insertion)
ChromosomeX
Putative gene structurejoin(804..861, 959..1032, 1082..1166, 1585..1937)
Map position1.42
Balancer
Map position of balancer
Sequence of primersExtFwd:GGAACGATTTCTCTGGGTAT,IntFwd:AAGTGGATGGGTGATAGGTG,ExtRev:GACAGGTATATCAGGAACAG,IntRev:TCGACGGAACGTAAATACAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079 
[ PubMed ID = 39870634 ] [ RRC reference ]

Tsai Y, Lin YC, Lee YH.
Octopamine-MAPK-SKN-1 signaling suppresses mating-induced oxidative stress in Caenorhabditis elegans gonads to protect fertility.
iScience 2023 26(3) 106162 
[ PubMed ID = 36876134 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS One 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]