| Allele Name | tm2004 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T04H1.9 |
| Gene Name | tbb-6 |
| Worm Base | Allele Name |
tm2004
|
| Gene Name |
tbb-6
|
| Sequence |
T04H1.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. A. Fraser: no synthetic phenotype with RNAi of F21H12.1, R05D3.4, F49E8.1, R04F11.3, Y47G6A.8, F54E12.2, K08F4.1, M01E5.5, F34D10.2, F34D10.3, C29A12.3 and F31E3.3. Dr. Y. Jin: no specific neuronal phenotype is found. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [T04H1] 27783/27784-[F55C5] 929/930 (950 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(27495..27660, 27717..27908, Z78198.1:104..433, Z78198.1:501..965, Z78198.1:1020..1147) |
| Map position | 3.96 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GAGGAGACTATGTCAATCGT,IntFwd:CGTTGGAACTTGTATCATGC,ExtRev:CGTCAGTGAACTCCGACTCT,IntRev:TTGCGACGGAACAGGCCTGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Hall AN, Morton EA, Walters R, Cuperus JT, Queitsch C.
Phenotypic tolerance for rDNA copy number variation within the natural range of C. elegans.
PLoS Genet 2025 21(7) e1011759
[ PubMed ID = 40601579 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.