分離済み変異体

tm1996

Allele Nametm1996
BalanceNot Required
OutCrossNot Accepted
Sequence NameT07E3.6
Gene Namepdf-1
Worm BaseAllele Name tm1996
Gene Name pdf-1
Sequence T07E3.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Husson: J. Biol. Chem. 283, 15241 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14212/14213-14800/14801 (588 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(12261..12333, 13137..13234, 14284..14655))
Map position-0.9
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGTGGAGGTACCAGGTTAA,IntFwd:CCATTCCGATGAGTCCGTTG,ExtRev:TCAAGGTCTCGCCTCTAGGA,IntRev:GAATACGATCCGGTGGCAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Molina-García L, Colinas-Fischer S, Benavides-Laconcha S, Lin L, Clark E, Treloar NJ, García-Minaur-Ortíz B, Butts M, Barnes CP, Barrios A.
Conflict during learning reconfigures the neural representation of positive valence and approach behavior.
Curr Biol 2024 34(23) 5470-5483.e7 
[ PubMed ID = 39547234 ] [ RRC reference ]

Ouaakki H, Joshi H, Rathor L, Han SM.
frpr-18, a neuropeptide receptor, regulates organismal lifespan and stress tolerance in C. elegans.
MicroPubl Biol 2023 2023  
[ PubMed ID = 37383174 ] [ RRC reference ]

Suo S, Harada K, Matsuda S, Kyo K, Wang M, Maruyama K, Awaji T, Tsuboi T.
Sexually Dimorphic Regulation of Behavioral States by Dopamine in Caenorhabditis elegans.
J Neurosci 2019 39(24) 4668-4683 
[ PubMed ID = 30988167 ] [ RRC reference ]

Huang H, Hayden DJ, Zhu CT, Bennett HL, Venkatachalam V, Skuja LL, Hart AC.
Gap Junctions and NCA Cation Channels Are Critical for Developmentally Timed Sleep and Arousal in Caenorhabditis elegans.
Genetics 2018 210(4) 1369-1381 
[ PubMed ID = 30323068 ] [ RRC reference ]

Hilbert ZA, Kim DH.
PDF-1 neuropeptide signaling regulates sexually dimorphic gene expression in shared sensory neurons of C. elegans.
Elife 2018 7  
[ PubMed ID = 30024377 ] [ RRC reference ]

Chen D, Taylor KP, Hall Q, Kaplan JM.
The Neuropeptides FLP-2 and PDF-1 Act in Concert To Arouse Caenorhabditis elegans Locomotion.
Genetics 2016 204(3) 1151-1159 
[ PubMed ID = 27585848 ] [ RRC reference ]

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223 
[ PubMed ID = 27720609 ] [ RRC reference ]

Sammut M, Cook SJ, Nguyen KCQ, Felton T, Hall DH, Emmons SW, Poole RJ, Barrios A.
Glia-derived neurons are required for sex-specific learning in C. elegans.
Nature 2015 526(7573) 385-390 
[ PubMed ID = 26469050 ] [ RRC reference ]

Choi S, Taylor KP, Chatzigeorgiou M, Hu Z, Schafer WR, Kaplan JM.
Sensory Neurons Arouse C. elegans Locomotion via Both Glutamate and Neuropeptide Release.
PLoS Genet 2015 11(7) e1005359 
[ PubMed ID = 26154367 ] [ RRC reference ]

Herrero A, Romanowski A, Meelkop E, Caldart CS, Schoofs L, Golombek DA.
Pigment-dispersing factor signaling in the circadian system of Caenorhabditis elegans.
Genes Brain Behav 2015 14(6) 493-501 
[ PubMed ID = 26113231 ] [ RRC reference ]

Kniazeva M, Zhu H, Sewell AK, Han M.
A Lipid-TORC1 Pathway Promotes Neuronal Development and Foraging Behavior under Both Fed and Fasted Conditions in C. elegans.
Dev Cell 2015 33(3) 260-71 
[ PubMed ID = 25892013 ] [ RRC reference ]

Choi S, Chatzigeorgiou M, Taylor KP, Schafer WR, Kaplan JM.
Analysis of NPR-1 reveals a circuit mechanism for behavioral quiescence in C. elegans.
Neuron 2013 78(5) 869-80 
[ PubMed ID = 23764289 ] [ RRC reference ]

Barrios A, Ghosh R, Fang C, Emmons SW, Barr MM.
PDF-1 neuropeptide signaling modulates a neural circuit for mate-searching behavior in C. elegans.
Nat Neurosci 2012 15(12) 1675-82 
[ PubMed ID = 23143519 ] [ RRC reference ]

Meelkop E, Temmerman L, Janssen T, Suetens N, Beets I, Van Rompay L, Shanmugam N, Husson SJ, Schoofs L.
PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying.
Mol Cell Endocrinol 2012 361(1-2) 232-40 
[ PubMed ID = 22579613 ] [ RRC reference ]

Temmerman L, Bogaerts A, Meelkop E, Cardoen D, Boerjan B, Janssen T, Schoofs L.
A proteomic approach to neuropeptide function elucidation.
Peptides 2012 34(1) 3-9 
[ PubMed ID = 21920396 ] [ RRC reference ]

Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L.
Neuropeptide GPCRs in C. elegans.
Front Endocrinol (Lausanne) 2012 3 167 
[ PubMed ID = 23267347 ] [ RRC reference ]

Janssen T, Husson SJ, Meelkop E, Temmerman L, Lindemans M, Verstraelen K, Rademakers S, Mertens I, Nitabach M, Jansen G, Schoofs L.
Discovery and characterization of a conserved pigment dispersing factor-like neuropeptide pathway in Caenorhabditis elegans.
J Neurochem 2009 111(1) 228-41 
[ PubMed ID = 19686386 ] [ RRC reference ]

Janssen T, Husson SJ, Lindemans M, Mertens I, Rademakers S, Ver Donck K, Geysen J, Jansen G, Schoofs L.
Functional characterization of three G protein-coupled receptors for pigment dispersing factors in Caenorhabditis elegans.
J Biol Chem 2008 283(22) 15241-9 
[ PubMed ID = 18390545 ] [ RRC reference ]