Allele Name | tm1988 |
Allele Type | 通常株 |
Sequence Name | T01H8.2 |
Gene Name | T01H8.2 |
Worm Base | Allele Name |
tm1988
|
Gene Name |
T01H8.2
|
Sequence |
T01H8.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 21928/21929-AGTGCCC-23586/23587 (1658 bp deletion + 7 bp insertion) |
Chromosome | I |
Putative gene structure | complement(join(21269..21394, 21437..21487, 21913..22082, 22132..22261, 22315..22399, 22645..22811, 23168..23392)) |
Map position | 2.96 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:TGTACCGTCGAGACGACTTG,IntRev:GCTCCTCATTGAAGCCCAAT,ExtFwd:GTGTCTTCGAACTCCCTACA,IntFwd:CCTACACTTCACCTGATCAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakai-Kato K, Homma H. d-Serine and d-Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor. J Neurosci 2020 40(39) 7531-7544
[ PubMed ID = 32855271 ]
[ RRC reference ]
|
Katane M, Saitoh Y, Uchiyama K, Nakayama K, Saitoh Y, Miyamoto T, Sekine M, Uda K, Homma H. Characterization of a homologue of mammalian serine racemase from Caenorhabditis elegans: the enzyme is not critical for the metabolism of serine in vivo. Genes Cells 2016 21(9) 966-77
[ PubMed ID = 27458110 ]
[ RRC reference ]
|
|