Home > 分離済み変異体 > tm1983

分離済み変異体

Allele Name		tm1983
Balance		Not Required
OutCross		Not Accepted
Sequence Name		ZC334.1
Gene Name		ins-26
Worm Base	Allele Name	tm1983
	Gene Name	ins-26
	Sequence	ZC334.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. Dr. J. Hubbard: no dauer formation at 20 & 25 C. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. P. Roy: normal muscle arm development. Dr. K. Ashrafi: normal Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. Q.L. Ch'ng: normal locomotion and egg-laying. Dr. P.W. Sternberg: normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		31783/31784-32376/32377 (593 bp deletion)
Chromosome		I
Putative gene structure		complement(join(31630..31718, 31887..32130))
Map position		22.89
Balancer
Map position of balancer
Sequence of primers		IntFwd:CAGAGGTAGATCACGGCACT,ExtFwd:CGGGGATGCAGAGGTAGATC,IntRev:TAGCCCGAATCTTCCTACAC,ExtRev:GTGATAAGCCTGGCAGGCTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW. Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2024 121(40) e2405391121  [ PubMed ID = 39316052 ] [ RRC reference ] Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S. A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2024 121(21) e2406565121  [ PubMed ID = 38753507 ] [ RRC reference ] Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW. Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans. bioRxiv 2024    [ PubMed ID = 38586049 ] [ RRC reference ] Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S. Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans. Elife 2021 10   [ PubMed ID = 34477553 ] [ RRC reference ] Yeon J, Takeishi A, Sengupta P. Chronic vs acute manipulations reveal degeneracy in a thermosensory neuron network. MicroPubl Biol 2021 2021   [ PubMed ID = 33474527 ] [ RRC reference ] Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR. Insulin-like signalling to the maternal germline controls progeny response to osmotic stress. Nat Cell Biol 2017 19(3) 252-257  [ PubMed ID = 28166192 ] [ RRC reference ] Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM. Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors. PLoS Genet 2016 12(8) e1006237  [ PubMed ID = 27487365 ] [ RRC reference ] Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M. CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans. Elife 2014 3 e04265  [ PubMed ID = 25432023 ] [ RRC reference ] Chen Y, Baugh LR. Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest. Dev Biol 2014 394(2) 314-26  [ PubMed ID = 25128585 ] [ RRC reference ] Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q. An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology. PLoS Genet 2014 10(3) e1004225  [ PubMed ID = 24675767 ] [ RRC reference ] Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M. Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development. EMBO J 2013 32(12) 1745-60  [ PubMed ID = 23665919 ] [ RRC reference ]