分離済み変異体

tm1978

Allele Nametm1978
BalanceNot Required
OutCrossNot Accepted
Sequence NameW02C12.3
Gene Namehlh-30
Worm BaseAllele Name tm1978 (x1)
Gene Name hlh-30
Sequence W02C12.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11784/11785-12494/12495 (710 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(10396..10566, 11129..11205, 11271..11421, 11471..11759, 12196..12271, 12330..12474, 12670..12798, 12894..12968, 13124..13219, 13331..13618))
Map position-1.01
BalancernT1
Map position of balancer
Sequence of primersExtFwd:CACTATAATCTGGCGGGCTA,IntFwd:CTAGCCGATCCGACCGAGAA,ExtRev:TGGCCCGTACTCTGTTAGAA,IntRev:CCAGTGACGGCAGCGACAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Das P, Ravi, Singh J.
Iron-deplete diet enhances Caenorhabditis elegans lifespan via oxidative stress response pathways.
EMBO J 2025 44(24) 7565-7589 
[ PubMed ID = 41214214 ] [ RRC reference ]

Jakovljević S, Radojević D, Bajić SS, Brdarić E, Mitrović H, Đokić J, Baumann L, Trifunovic A, Golić N, Dinić M.
Bacterial exopolysaccharides mediate activation of flavin-containing monooxygenase 2 to extend lifespan in Caenorhabditis elegans.
Cell Commun Signal 2025 24(1) 9 
[ PubMed ID = 41318463 ] [ RRC reference ]

Ricaurte-Perez C, Gill JP, Wall PK, Dubuisson O, DeLeo KR, Bohnert KA, Johnson AE.
DAF-16/FOXO and HLH-30/TFEB comprise a cooperative regulatory axis controlling tubular lysosome induction in C. elegans.
Nat Commun 2025 16(1) 9878 
[ PubMed ID = 41213901 ] [ RRC reference ]

Bördén K, Vellai T, Sigmond T.
Developing Endogenous Autophagy Reporters in Caenorhabditis elegans to Monitor Basal and Starvation-Induced Autophagy.
Int J Mol Sci 2025 26(20)  
[ PubMed ID = 41155471 ] [ RRC reference ]

Zhou Y, Ahsan FM, Emans SW, Soukas AA.
The nuclear pore complex connects energy sensing to transcriptional plasticity in longevity.
Mol Cell 2025 85(19) 3605-3622.e10 
[ PubMed ID = 40992375 ] [ RRC reference ]

Rao R, Aballay A, Singh J.
Inhibition of the UFD-1-NPL-4 complex triggers an aberrant immune response in Caenorhabditis elegans.
Elife 2025 13  
[ PubMed ID = 40928215 ] [ RRC reference ]

Zhong R, Richardson CE.
Expansion of lysosomal capacity in early adult neurons driven by TFEB/HLH-30 protects dendrite maintenance during aging in Caenorhabditis elegans.
PLoS Biol 2025 23(9) e3002957 
[ PubMed ID = 41026805 ] [ RRC reference ]

Tan EP, Lyang N, Doroodian S, Sanz-Martinez P, Xu J, Zaretski S, Nieto-Torres JL, Ebata H, Lim SHY, Hou WC, Clay KJ, Yoon L, Massey LA, Rhoades D, Garza D, Johnson KA, To A, Ambaye L, Bentley EP, Petrascheck M, Stolz A, Kelly JW, Hansen M.
Autophagy activator AA-20 improves proteostasis and extends Caenorhabditis elegans lifespan.
Proc Natl Acad Sci U S A 2025 122(32) e2423455122 
[ PubMed ID = 40758884 ] [ RRC reference ]

Wu P, Vandemeulebroucke L, Cai H, Braeckman BP.
The Proprotein Convertase BLI-4 Is Required for Axenic Dietary Restriction Mediated Longevity in Caenorhabditis elegans.
Aging Cell 2025 24(7) e70058 
[ PubMed ID = 40200707 ] [ RRC reference ]

Nonninger TJ, Mak J, Gerisch B, Ramponi V, Kawamura K, Ripa R, Schilling K, Latza C, Kölschbach J, Serrano M, Antebi A.
A TFEB-TGFβ axis systemically regulates diapause, stem cell resilience and protects against a senescence-like state.
Nat Aging 2025 5(7) 1340-1357 
[ PubMed ID = 40588651 ] [ RRC reference ]

Li TY, Gao AW, Yang R, Sun Y, Lei Y, Li X, Chen L, Liu YJ, Arey RN, Morales K, Liu RB, Wang W, Zhou A, Zhao TJ, Li W, Lalou A, Wang Q, Lima T, Houtkooper RH, Auwerx J.
A lysosomal surveillance response to stress extends healthspan.
Nat Cell Biol 2025 27(7) 1083-1097 
[ PubMed ID = 40571723 ] [ RRC reference ]

Sun CL, Xu C, Itani O, Christensen EL, Vijay H, Ho J, Correa-Medina A, Klingler CB, Mathew ND, Flibotte S, Humphreys IR, Rubalcaba DD, Ritter AE, Desbois M, Grill B, Crowder CM.
Biased regulation of protein synthesis and hypoxic death by a conditional raptor mutation.
Curr Biol 2025 35(11) 2567-2582.e5 
[ PubMed ID = 40339571 ] [ RRC reference ]

Shalash R, Solomon DM, Levi-Ferber M, von Chrzanowski H, Atrash MK, Nakar B, Avivi MY, Hauschner H, Swisa A, Meléndez A, Shav-Tal Y, Henis-Korenblit S.
HLH-30/TFEB Rewires the Chaperone Network to Promote Proteostasis Upon Perturbations to the Coenzyme A and Iron-Sulfur Cluster Biosynthesis Pathways.
Aging Cell 2025 24(6) e70038 
[ PubMed ID = 40304211 ] [ RRC reference ]

Guo Y, Zhang Q, Zhang B, Pan T, Ronan EA, Huffman A, He Y, Inoki K, Liu J, Xu XZS.
Dietary cinnamon promotes longevity and extends healthspan via mTORC1 and autophagy signaling.
Aging Cell 2025 24(4) e14448 
[ PubMed ID = 39760475 ] [ RRC reference ]

Garcia-Sanchez JA, Bonnet E, Loubatier C, Doye A, Paillier G, Segui F, Larbret F, Chaintreuil P, Batistic L, Torre C, Deckert M, Polanowska J, Munro P, Boyer L, Visvikis O.
Evolutionary conserved regulation of TFEB stability by the E3 ubiquitin ligase WWP2 modulates response to stress in vivo.
iScience 2025 28(2) 111838 
[ PubMed ID = 39995862 ] [ RRC reference ]

Liu X, Chang Z, Sun P, Cao B, Wang Y, Fang J, Pei Y, Chen B, Zou W.
MONITTR allows real-time imaging of transcription and endogenous proteins in C. elegans.
J Cell Biol 2025 224(1)  
[ PubMed ID = 39400293 ] [ RRC reference ]

Guerrero-Gómez D, Cabello J, Miranda-Vizuete A.
Insulin receptor substrate family member IST-1 regulates the development of Caenorhabditis elegansage-1 and aap-1 mutants.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40642152 ] [ RRC reference ]

Das P, Aballay A, Singh J.
Calcineurin inhibition enhances Caenorhabditis elegans lifespan by defecation defects-mediated calorie restriction and nuclear hormone signaling.
Elife 2024 12  
[ PubMed ID = 39485281 ] [ RRC reference ]

Taylor SKB, Hartman JH, Gupta BP.
The neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(43) e2403906121 
[ PubMed ID = 39418305 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]