分離済み変異体

tm1978

Allele Name

tm1978

Allele Type

通常株

Sequence Name

W02C12.3

Gene Name

hlh-30

Worm Base

Allele Name

tm1978

Gene Name

hlh-30

Sequence

W02C12.3

Phenotype

homozygous viable

Mutation site

11784/11785-12494/12495 (710 bp deletion)

Chromosome

Putative gene structure

complement(join(10396..10566, 11129..11205, 11271..11421, 11471..11759, 12196..12271, 12330..12474, 12670..12798, 12894..12968, 13124..13219, 13331..13618))

Map position

-1.01

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CACTATAATCTGGCGGGCTA,IntFwd:CTAGCCGATCCGACCGAGAA,ExtRev:TGGCCCGTACTCTGTTAGAA,IntRev:CCAGTGACGGCAGCGACAAA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Zheng T, Luo Q, Han C, Zhou J, Gong J, Chun L, Xu XZS, Liu J.
Cytoplasmic and mitochondrial aminoacyl-tRNA synthetases differentially regulate lifespan in Caenorhabditis elegans.
iScience 2022 25(11) 105266
[ PubMed ID = 36304099 ] [ RRC reference ]

Yang R, Kang Y, Duan J, Zou C, Wu Q.
The p38 MAPK/PMK-1 Pathway Is Required for Resistance to Nocardia farcinica Infection in Caenorhabditis elegance.
Pathogens 2022 11(10)
[ PubMed ID = 36297128 ] [ RRC reference ]

Wong SQ, Ryan CJ, Bonal DM, Mills J, Lapierre LR.
Neuronal HLH-30/TFEB modulates peripheral mitochondrial fragmentation to improve thermoresistance in Caenorhabditis elegans.
Aging Cell 2023 22(3) e13741
[ PubMed ID = 36419219 ] [ RRC reference ]

Webster AK, Chitrakar R, Taylor SM, Baugh LR.
Alternative somatic and germline gene-regulatory strategies during starvation-induced developmental arrest.
Cell Rep 2022 41(2) 111473
[ PubMed ID = 36223742 ] [ RRC reference ]

Palikaras K, Mari M, Ploumi C, Princz A, Filippidis G, Tavernarakis N.
Age-dependent nuclear lipid droplet deposition is a cellular hallmark of aging in Caenorhabditis elegans.
Aging Cell 2023 22(4) e13788
[ PubMed ID = 36718841 ] [ RRC reference ]

Ogawa T, Masumura K, Kohara Y, Kanai M, Soga T, Ohya Y, Blackwell TK, Mizunuma M.
S-adenosyl-L-homocysteine extends lifespan through methionine restriction effects.
Aging Cell 2022 21(5) e13604
[ PubMed ID = 35388610 ] [ RRC reference ]

Mohankumar A, Kalaiselvi D, Thiruppathi G, Muthusaravanan S, Vijayakumar S, Suresh R, Tawata S, Sundararaj P.
Santalol Isomers Inhibit Transthyretin Amyloidogenesis and Associated Pathologies in Caenorhabditis elegans.
Front Pharmacol 2022 13 924862
[ PubMed ID = 35784752 ] [ RRC reference ]

McDonagh A, Crew J, van der Linden AM.
Dietary vitamin B12 regulates chemosensory receptor gene expression via the MEF2 transcription factor in Caenorhabditis elegans.
G3 (Bethesda) 2022 12(6)
[ PubMed ID = 35512190 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178
[ PubMed ID = 35511794 ] [ RRC reference ]

Guo P, Wang P, Liu L, Wang P, Lin G, Qu Z, Yu Z, Liu N.
Naringin Alleviates Glucose-Induced Aging by Reducing Fat Accumulation and Promoting Autophagy in Caenorhabditis elegans.
Nutrients 2023 15(4)
[ PubMed ID = 36839265 ] [ RRC reference ]

Sang Y, Ren J, Aballay A.
The transcription factor HLH-26 controls probiotic-mediated protection against intestinal infection through up-regulation of the Wnt/BAR-1 pathway.
PLoS Biol 2022 20(3) e3001581
[ PubMed ID = 35263319 ] [ RRC reference ]

Qu Y, Shi L, Liu Y, Huang L, Luo HR, Wu GS.
Orientin Prolongs the Longevity of Caenorhabditis elegans and Postpones the Development of Neurodegenerative Diseases via Nutrition Sensing and Cellular Protective Pathways.
Oxid Med Cell Longev 2022 2022 8878923
[ PubMed ID = 35237385 ] [ RRC reference ]

Mony VK, Drangowska-Way A, Albert R, Harrison E, Ghaddar A, Horak MK, Ke W, O'Rourke EJ.
Context-specific regulation of lysosomal lipolysis through network-level diverting of transcription factor interactions.
Proc Natl Acad Sci U S A 2021 118(41)
[ PubMed ID = 34607947 ] [ RRC reference ]

Li H, Yu X, Meng F, Zhao Z, Guan S, Wang L.
Ferulic Acid Supplementation Increases Lifespan and Stress Resistance via Insulin/IGF-1 Signaling Pathway in C. elegans.
Int J Mol Sci 2021 22(8)
[ PubMed ID = 33924155 ] [ RRC reference ]

Cooper JF, Guasp RJ, Arnold ML, Grant BD, Driscoll M.
Stress increases in exopher-mediated neuronal extrusion require lipid biosynthesis, FGF, and EGF RAS/MAPK signaling.
Proc Natl Acad Sci U S A 2021 118(36)
[ PubMed ID = 34475208 ] [ RRC reference ]

Choi LS, Shi C, Ashraf J, Sohrabi S, Murphy CT.
Oleic Acid Protects Caenorhabditis Mothers From Mating-Induced Death and the Cost of Reproduction.
Front Cell Dev Biol 2021 9 690373
[ PubMed ID = 34179018 ] [ RRC reference ]

Dinić M, Herholz M, Kačarević U, Radojević D, Novović K, Đokić J, Trifunović A, Golić N.
Host-commensal interaction promotes health and lifespan in Caenorhabditis elegans through the activation of HLH-30/TFEB-mediated autophagy.
Aging (Albany NY) 2021 13(6) 8040-8054
[ PubMed ID = 33770762 ] [ RRC reference ]

Lee K, Escobar I, Jang Y, Kim W, Ausubel FM, Mylonakis E.
In the Model Host Caenorhabditis elegans, Sphingosine-1-Phosphate-Mediated Signaling Increases Immunity toward Human Opportunistic Bacteria.
Int J Mol Sci 2020 21(21)
[ PubMed ID = 33105563 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9
[ PubMed ID = 32367802 ] [ RRC reference ]

Sun Y, Li M, Zhao D, Li X, Yang C, Wang X.
Lysosome activity is modulated by multiple longevity pathways and is important for lifespan extension in C. elegans.
Elife 2020 9
[ PubMed ID = 32482227 ] [ RRC reference ]