分離済み変異体

tm1968

Allele Nametm1968
BalanceNot Required
OutCrossNot Accepted
Sequence NameY37E11AR.2
Gene Namesiah-1
Worm BaseAllele Name tm1968
Gene Name siah-1
Sequence Y37E11AR.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Matsumoto: no copper sensitivity. Dr. C. Rongo: Normal GLR-1::GFP localization. Dr. O. Blacque: dye-filling normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10015/10016-10639/10640 (624 bp deletion)
ChromosomeIV
Putative gene structurejoin(8465..8651, 9447..9608, 9662..9895, 10152..10727, 11296..11350, 11496..11541)
Map position-2.39
Balancer
Map position of balancer
Sequence of primersIntRev:TCTCACCTCTGTGGAGTATC,ExtRev:TCATTTGGGTGGCGCCTGAA,ExtFwd:GCTGCGTAGTGAATGCGCTT,IntFwd:CTTGGAGCCCAGAACTAGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sun L, Liu J, Lu M, Zhou Y, Guo S, Qin Z, Wang Z, Sun X.
Inactivation of SIAH-1 E3 ligase attenuates Aβ toxicity by suppressing ubiquitin-dependent DVE-1 degradation in Caenorhabditis elegans models of Alzheimer's disease.
J Biol Chem 2025 301(6) 110226 
[ PubMed ID = 40349774 ] [ RRC reference ]

Malin JA, Kinet MJ, Abraham MC, Blum ES, Shaham S.
Transcriptional control of non-apoptotic developmental cell death in C. elegans.
Cell Death Differ 2016 23(12) 1985-1994 
[ PubMed ID = 27472063 ] [ RRC reference ]

Kinet MJ, Malin JA, Abraham MC, Blum ES, Silverman MR, Lu Y, Shaham S.
HSF-1 activates the ubiquitin proteasome system to promote non-apoptotic developmental cell death in C. elegans.
Elife 2016 5  
[ PubMed ID = 26952214 ] [ RRC reference ]

De Arras L, Seng A, Lackford B, Keikhaee MR, Bowerman B, Freedman JH, Schwartz DA, Alper S.
An evolutionarily conserved innate immunity protein interaction network.
J Biol Chem 2013 288(3) 1967-78 
[ PubMed ID = 23209288 ] [ RRC reference ]