分離済み変異体

tm1962

Allele Nametm1962
BalanceNot Required
OutCrossNot Accepted
Sequence NameF14F3.2
Gene Namegit-1
Worm BaseAllele Name tm1962
Gene Name git-1
Sequence F14F3.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Leroux: Dyf normal. Dr. Y. Jin: no specific neuronal phenotype is found. Dr. K. Shen: no apparent synaptic phenotype in HSNL, DA9, AVE and AFD as determined by examining GFP::RAB-3 or VAMP::YFP. Dr. H. Sawa: non-Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31052/31053-GAAACCCATTCAAGCTATAAATA-31535/31536 (483 bp deletion + 23 bp insertion)
ChromosomeX
Putative gene structurejoin(29657..29681, 29728..29847, 29995..30076, 30132..30203, 30260..30412, 30481..30664, 30711..31016, 31061..31257, 31301..31501, 31551..31733, 32006..32184, 32233..32348, 32398..32484, 32793..32900)
Map position2.23
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCAGAGGCGCTTGACCGTA,IntFwd:AAGTCGAATGGGCGTCGGTA,ExtRev:TTCCCACTGGTGGCATAACT,IntRev:TAGCCAATGGAGATGGCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yuval O, Iosilevskii Y, Meledin A, Podbilewicz B, Shemesh T.
Neuron tracing and quantitative analyses of dendritic architecture reveal symmetrical three-way-junctions and phenotypes of git-1 in C. elegans.
PLoS Comput Biol 2021 17(7) e1009185 
[ PubMed ID = 34280180 ] [ RRC reference ]

Suman SK, Daday C, Ferraro T, Vuong-Brender T, Tak S, Quintin S, Robin F, Gräter F, Labouesse M.
The plakin domain of C. elegans VAB-10/plectin acts as a hub in a mechanotransduction pathway to promote morphogenesis.
Development 2019 146(24)  
[ PubMed ID = 31784459 ] [ RRC reference ]

Lardennois A, Pásti G, Ferraro T, Llense F, Mahou P, Pontabry J, Rodriguez D, Kim S, Ono S, Beaurepaire E, Gally C, Labouesse M.
An actin-based viscoplastic lock ensures progressive body-axis elongation.
Nature 2019 573(7773) 266-270 
[ PubMed ID = 31462781 ] [ RRC reference ]

Zhang Y, Li W, Li L, Li Y, Fu R, Zhu Y, Li J, Zhou Y, Xiong S, Zhang H.
Structural damage in the C. elegans epidermis causes release of STA-2 and induction of an innate immune response.
Immunity 2015 42(2) 309-320 
[ PubMed ID = 25692704 ] [ RRC reference ]

Morrissey MA, Keeley DP, Hagedorn EJ, McClatchey STH, Chi Q, Hall DH, Sherwood DR.
B-LINK: a hemicentin, plakin, and integrin-dependent adhesion system that links tissues by connecting adjacent basement membranes.
Dev Cell 2014 31(3) 319-331 
[ PubMed ID = 25443298 ] [ RRC reference ]

Peters EC, Gossett AJ, Goldstein B, Der CJ, Reiner DJ.
Redundant canonical and noncanonical Caenorhabditis elegans p21-activated kinase signaling governs distal tip cell migrations.
G3 (Bethesda) 2013 3(2) 181-95 
[ PubMed ID = 23390595 ] [ RRC reference ]

Zhang H, Landmann F, Zahreddine H, Rodriguez D, Koch M, Labouesse M.
A tension-induced mechanotransduction pathway promotes epithelial morphogenesis.
Nature 2011 471(7336) 99-103 
[ PubMed ID = 21368832 ] [ RRC reference ]

Lucanic M, Cheng HJ.
A RAC/CDC-42-independent GIT/PIX/PAK signaling pathway mediates cell migration in C. elegans.
PLoS Genet 2008 4(11) e1000269 
[ PubMed ID = 19023419 ] [ RRC reference ]

Patel MR, Lehrman EK, Poon VY, Crump JG, Zhen M, Bargmann CI, Shen K.
Hierarchical assembly of presynaptic components in defined C. elegans synapses.
Nat Neurosci 2006 9(12) 1488-98 
[ PubMed ID = 17115039 ] [ RRC reference ]