| Allele Name | tm1961 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C29A12.4 |
| Gene Name | nrx-1 |
| Worm Base | Allele Name |
tm1961
|
| Gene Name |
nrx-1
|
| Sequence |
C29A12.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. Y. Jin: normal behavior. Dr. J. Rand: normal thermotaxis. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 22874/22875-23302/23303 (428 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(18021..18139, 18191..18346, 18685..18748, 19113..19280, 19324..19423, 19870..19943, 20010..20124, 20253..20413, 20741..20899, 21514..21871, 21958..22554, 22600..22697, 22743..22862, 22913..23021, 23069..23279, 23332..23529, 23571..23926, 24108..24287, 24714..25149, 25242..25345, 28528..28649, 31064..31157, 35431..35490, 38642..38781, 38835..38972, 39083..39193, 39284..39418) |
| Map position | 2.83 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:TCTAACCTCCCGTTGAGCAT,ExtRev:TGGCCAGATGTTCGATAAGT,IntFwd:ATCTGGCCGATCAAAGTTAC,ExtFwd:GCAGTATGCACCTGAACTTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J. Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour. PLoS One 2021 16(5) e0243121
[ PubMed ID = 34043629 ]
[ RRC reference ]
|
Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife 2018 7
[ PubMed ID = 30039797 ]
[ RRC reference ]
|
Rodríguez-Ramos Á, Gámez-Del-Estal MM, Porta-de-la-Riva M, Cerón J, Ruiz-Rubio M. Impaired Dopamine-Dependent Locomotory Behavior of C. elegans Neuroligin Mutants Depends on the Catechol-O-Methyltransferase COMT-4. Behav Genet 2017 47(6) 596-608
[ PubMed ID = 28879499 ]
[ RRC reference ]
|
Chen H, Li H, Wang D. Graphene Oxide Dysregulates Neuroligin/NLG-1-Mediated Molecular Signaling in Interneurons in Caenorhabditis elegans. Sci Rep 2017 7 41655
[ PubMed ID = 28128356 ]
[ RRC reference ]
|
Calahorro F, Ruiz-Rubio M. Human alpha- and beta-NRXN1 isoforms rescue behavioral impairments of Caenorhabditis elegans neurexin-deficient mutants. Genes Brain Behav 2013 12(4) 453-64
[ PubMed ID = 23638761 ]
[ RRC reference ]
|
Calahorro F, Ruiz-Rubio M. Caenorhabditis elegans as an experimental tool for the study of complex neurological diseases: Parkinson's disease, Alzheimer's disease and autism spectrum disorder. Invert Neurosci 2011 11(2) 73-83
[ PubMed ID = 22068627 ]
[ RRC reference ]
|
Calahorro F, Alejandre E, Ruiz-Rubio M. Osmotic avoidance in Caenorhabditis elegans: synaptic function of two genes, orthologues of human NRXN1 and NLGN1, as candidates for autism. J Vis Exp 2009 (34)
[ PubMed ID = 20010541 ]
[ RRC reference ]
|
|