Allele Name | tm1956 |
Allele Type | 通常株 |
Sequence Name | K06H7.4 |
Gene Name | grp-1 |
Worm Base | Allele Name |
tm1956
|
Gene Name |
grp-1
|
Sequence |
K06H7.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. G. Garriga: extra AVM/PVM neurons. Dr. H. Sawa: no Psa phenotype. Dr. O. Blacque: dye-filling normal. Dr. Y. Jin: no movement phenotype, grows well. Dr. O. Hobert: ASE differentiation defective. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 6313/6314-T-7296/7297 (983 bp deletion + 1 bp insertion) |
Chromosome | III |
Putative gene structure | join(5381..5399, 5451..5548, 5866..6051, 6126..6470, 6533..6744, 7319..7448, 7498..7689) |
Map position | -0.38 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:GGACTATCGGAGACGGAGAA,ExtFwd:CGCGGTATTCAGGTTTGTAC,IntRev:GTCCATCCGATAGAGAGAAT,ExtRev:CGGTGCCATCATTCGTGATA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O. A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans. PLoS Genet 2011 7(6) e1002109
[ PubMed ID = 21698137 ]
[ RRC reference ]
|
Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G. Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans. Genetics 2014 198(1) 229-47
[ PubMed ID = 25053664 ]
[ RRC reference ]
|
Tehrani N, Del Rosario J, Dominguez M, Kalb R, Mano I. The insulin/IGF signaling regulators cytohesin/GRP-1 and PIP5K/PPK-1 modulate susceptibility to excitotoxicity in C. elegans. PLoS One 2014 9(11) e113060
[ PubMed ID = 25422944 ]
[ RRC reference ]
|
Denning DP, Hatch V, Horvitz HR. Programmed elimination of cells by caspase-independent cell extrusion in C. elegans. Nature 2012 488(7410) 226-30
[ PubMed ID = 22801495 ]
[ RRC reference ]
|
|