分離済み変異体

tm1954

Allele Nametm1954
BalanceNot Required
OutCrossNot Accepted
Sequence NameF54F3.3
Gene Namelipl-1
Worm BaseAllele Name tm1954
Gene Name lipl-1
Sequence F54F3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12187/12188-CCCCTCCC-13220/13221 (1033 bp deletion + 8 bp insertion)
ChromosomeV
Putative gene structurejoin(12340..12432, 12542..12641, 12803..13431, 13479..13754, 13808..13927)
Map position4.73
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTTTGGTACGGTTGCAGAG,IntFwd:ACTACGACTCCTTTCCGTGA,ExtRev:GATATGCTGGCAGGATAAAG,IntRev:CCCCAGATGAAATCGAGATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
DuMez-Kornegay RN, Baker LS, Morris AJ, DeLoach WLM, Dowen RH.
Kombucha Tea-associated microbes remodel host metabolic pathways to suppress lipid accumulation.
PLoS Genet 2024 20(3) e1011003 
[ PubMed ID = 38547054 ] [ RRC reference ]

Oh M, Yeom J, Schraermeyer U, Julien-Schraermeyer S, Lim YH.
Remofuscin induces xenobiotic detoxification via a lysosome-to-nucleus signaling pathway to extend the Caenorhabditis elegans lifespan.
Sci Rep 2022 12(1) 7161 
[ PubMed ID = 35504961 ] [ RRC reference ]

Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A.
Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival.
PLoS Biol 2019 17(5) e3000245 
[ PubMed ID = 31086360 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration.
Elife 2018 7  
[ PubMed ID = 30461420 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80 
[ PubMed ID = 27884963 ] [ RRC reference ]

O'Rourke EJ, Ruvkun G.
MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability.
Nat Cell Biol 2013 15(6) 668-76 
[ PubMed ID = 23604316 ] [ RRC reference ]

O'Rourke D, Baban D, Demidova M, Mott R, Hodgkin J.
Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum.
Genome Res 2006 16(8) 1005-16 
[ PubMed ID = 16809667 ] [ RRC reference ]