分離済み変異体

tm1944

Allele Nametm1944
BalanceNot Required
OutCrossNot Accepted
Sequence NamePAR2.3
Gene Nameaak-1
Worm BaseAllele Name tm1944
Gene Name aak-1
Sequence PAR2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. L. Avery: mildly sensitive to long-term starvation (e.g. 15 days of starvation as L1). Dr. K. Ashrafi: normal Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5139/5140-5757/5758 (618 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(2399..2524, 2582..2670, 3146..3280, 3628..4180, 4408..4458, 4608..4816, 4865..5126, 5406..5731, 6094..6211)
Map position-0.06
Balancer
Map position of balancer
Sequence of primersExtFwd:CGAACCTCTGCAACACTCTG,ExtRev:ACTCAATCGCGTGACCTCCT,IntFwd:TCGATACGGAACCAACTGTG,IntRev:GTGACCTCCTCAGACCCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turmel-Couture S, Martel PO, Beaulieu L, Lechasseur X, Fotso Dzuna LV, Narbonne P.
Bidirectional transfer of a small membrane-impermeable molecule between the Caenorhabditis elegans intestine and germline.
J Biol Chem 2024 300(12) 107963 
[ PubMed ID = 39510179 ] [ RRC reference ]

Cheng E, Lu R, Gerhold AR.
Non-autonomous insulin signaling delays mitotic progression in C. elegans germline stem and progenitor cells.
PLoS Genet 2024 20(12) e1011351 
[ PubMed ID = 39715269 ] [ RRC reference ]

Al-Refaie N, Padovani F, Hornung J, Pudelko L, Binando F, Del Carmen Fabregat A, Zhao Q, Towbin BD, Cenik ES, Stroustrup N, Padeken J, Schmoller KM, Cabianca DS.
Fasting shapes chromatin architecture through an mTOR/RNA Pol I axis.
Nat Cell Biol 2024 26(11) 1903-1917 
[ PubMed ID = 39300311 ] [ RRC reference ]

Wong C, Jurczak EM, Roy R.
Neuronal exosomes transport an miRISC cargo to preserve stem cell integrity during energy stress.
Cell Rep 2024 43(10) 114851 
[ PubMed ID = 39392750 ] [ RRC reference ]

Kim Y, Nam S, Lim J, Jang M.
Autumn Olive (Elaeagnus umbellata Thunb.) Berries Improve Lipid Metabolism and Delay Aging in Middle-Aged Caenorhabditis elegans.
Int J Mol Sci 2024 25(6)  
[ PubMed ID = 38542392 ] [ RRC reference ]

Kim Y, Lee SB, Cho M, Choe S, Jang M.
Indian Almond (Terminalia catappa Linn.) Leaf Extract Extends Lifespan by Improving Lipid Metabolism and Antioxidant Activity Dependent on AMPK Signaling Pathway in Caenorhabditis elegans under High-Glucose-Diet Conditions.
Antioxidants (Basel) 2023 13(1)  
[ PubMed ID = 38275634 ] [ RRC reference ]

Chipman LB, Luc S, Nicastro IA, Hulahan JJ, Dann DC, Bodas DM, Pasquinelli AE.
Expression, not sequence, distinguishes miR-238 from its miR-239ab sister miRNAs in promoting longevity in Caenorhabditis elegans.
PLoS Genet 2023 19(11) e1011055 
[ PubMed ID = 38011256 ] [ RRC reference ]

Wong C, Kadekar P, Jurczak E, Roy R.
Germline stem cell integrity and quiescence are controlled by an AMPK-dependent neuronal trafficking pathway.
PLoS Genet 2023 19(4) e1010716 
[ PubMed ID = 37058536 ] [ RRC reference ]

Kawano T, Kashiwagi M, Kanuka M, Chen CK, Yasugaki S, Hatori S, Miyazaki S, Tanaka K, Fujita H, Nakajima T, Yanagisawa M, Nakagawa Y, Hayashi Y.
ER proteostasis regulators cell-non-autonomously control sleep.
Cell Rep 2023 42(3) 112267 
[ PubMed ID = 36924492 ] [ RRC reference ]

Sun B, Sherrin M, Roy R.
Unscheduled epigenetic modifications cause genome instability and sterility through aberrant R-loops following starvation.
Nucleic Acids Res 2023 51(1) 84-98 
[ PubMed ID = 36504323 ] [ RRC reference ]

McLachlan IG, Kramer TS, Dua M, DiLoreto EM, Gomes MA, Dag U, Srinivasan J, Flavell SW.
Diverse states and stimuli tune olfactory receptor expression levels to modulate food-seeking behavior.
Elife 2022 11  
[ PubMed ID = 36044259 ] [ RRC reference ]

Ju S, Chen H, Wang S, Lin J, Ma Y, Aroian RV, Peng D, Sun M.
C. elegans monitor energy status via the AMPK pathway to trigger innate immune responses against bacterial pathogens.
Commun Biol 2022 5(1) 643 
[ PubMed ID = 35773333 ] [ RRC reference ]

Houri-Zeevi L, Teichman G, Gingold H, Rechavi O.
Stress resets ancestral heritable small RNA responses.
Elife 2021 10  
[ PubMed ID = 33729152 ] [ RRC reference ]

Qu Z, Ji S, Zheng S.
BRAF Controls the Effects of Metformin on Neuroblast Cell Divisions in C. elegans.
Int J Mol Sci 2020 22(1)  
[ PubMed ID = 33375360 ] [ RRC reference ]

Martin E, Bonnamour G, Jenna S.
AMPK and autophagy control embryonic elongation as part of a RhoA-like morphogenic program in nematode.
Small GTPases 2020 11(3) 186-193 
[ PubMed ID = 29172954 ] [ RRC reference ]

Kadekar P, Roy R.
AMPK regulates germline stem cell quiescence and integrity through an endogenous small RNA pathway.
PLoS Biol 2019 17(6) e3000309 
[ PubMed ID = 31166944 ] [ RRC reference ]

Kadekar P, Chaouni R, Clark E, Kazanets A, Roy R.
Genome-wide surveys reveal polarity and cytoskeletal regulators mediate LKB1-associated germline stem cell quiescence.
BMC Genomics 2018 19(1) 462 
[ PubMed ID = 29907081 ] [ RRC reference ]

Webster CM, Pino EC, Carr CE, Wu L, Zhou B, Cedillo L, Kacergis MC, Curran SP, Soukas AA.
Genome-wide RNAi Screen for Fat Regulatory Genes in C. elegans Identifies a Proteostasis-AMPK Axis Critical for Starvation Survival.
Cell Rep 2017 20(3) 627-640 
[ PubMed ID = 28723566 ] [ RRC reference ]

Lee J, Yue Y, Park Y, Lee SH.
3,3'-Diindolylmethane Suppresses Adipogenesis Using AMPKα-Dependent Mechanism in 3T3-L1 Adipocytes and Caenorhabditis elegans.
J Med Food 2017 20(7) 646-652 
[ PubMed ID = 28459610 ] [ RRC reference ]

Wang Y, Xie C, Diao Z, Liang B.
Calcineurin Antagonizes AMPK to Regulate Lipolysis in Caenorhabditis elegans.
Molecules 2017 22(7)  
[ PubMed ID = 28672869 ] [ RRC reference ]