分離済み変異体

tm1937

Allele Nametm1937
BalanceNot Required
OutCrossNot Accepted
Sequence NameC43E11.2
Gene Namemus-81
Worm BaseAllele Name tm1937
Gene Name mus-81
Sequence C43E11.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Leroux: Dyf normal. Dr. A. Fraser: no synthetic phenotype with Y47G6A.8 (RNAi), Y56A3A.27 (RNAi) and T04A11.6 (RNAi). Dr. S. Boulton: EMBO J. 26, 3384 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35894/35895-37086/37087 (1192 bp deletion)
ChromosomeI
Putative gene structurejoin(36106..36170, 36217..36344, 36405..36835, 37403..37723, 37779..38171)
Map position-1.52
Balancer
Map position of balancer
Sequence of primersIntRev:GGCTGAATGGAACACCCGAA,ExtRev:CATCAGCTGTCGGACCCAAG,IntFwd:AGGTATTTGGCAGACTTACC,ExtFwd:CGCTCCACGATCAATAGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fernández-Fernández N, Chacón M, Camino LP, Garcia-Muse T.
Damage-induced phosphorylation of BRC-1/BRD-1 in meiosis preserves germline integrity.
Nucleic Acids Res 2025 53(18)  
[ PubMed ID = 40990247 ] [ RRC reference ]

Yuan H, Odiba AS, Liao G, Zhou Z, Fang W, Jin C, Li S, Liu X, Wang B.
Separation-of-Function Alleles of smc-5 Reveal Domain-Specific Defects and a Conserved Residue Critical for Genome Maintenance.
Biomolecules 2025 15(6)  
[ PubMed ID = 40563397 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716 
[ PubMed ID = 36176234 ] [ RRC reference ]

Odiba AS, Ezechukwu CS, Liao G, Li S, Chen Z, Liu X, Fang W, Jin C, Wang B.
Loss of NSE-4 Perturbs Genome Stability and DNA Repair in Caenorhabditis elegans.
Int J Mol Sci 2022 23(13)  
[ PubMed ID = 35806213 ] [ RRC reference ]

Dello Stritto MR, Vojtassakova N, Velkova M, Hamminger P, Ulm P, Jantsch V.
The topoisomerase 3 zinc finger domain cooperates with the RMI1 scaffold to promote stable association of the BTR complex to recombination intermediates in the Caenorhabditis elegans germline.
Nucleic Acids Res 2022 50(10) 5652-5671 
[ PubMed ID = 35639927 ] [ RRC reference ]

Dello Stritto MR, Bauer B, Barraud P, Jantsch V.
DNA topoisomerase 3 is required for efficient germ cell quality control.
J Cell Biol 2021 220(6)  
[ PubMed ID = 33798260 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621 
[ PubMed ID = 32414869 ] [ RRC reference ]

Bellelli R, Youds J, Borel V, Svendsen J, Pavicic-Kaltenbrunner V, Boulton SJ.
Synthetic Lethality between DNA Polymerase Epsilon and RTEL1 in Metazoan DNA Replication.
Cell Rep 2020 31(8) 107675 
[ PubMed ID = 32460026 ] [ RRC reference ]

Nguyen H, Labella S, Silva N, Jantsch V, Zetka M.
C. elegans ZHP-4 is required at multiple distinct steps in the formation of crossovers and their transition to segregation competent chiasmata.
PLoS Genet 2018 14(10) e1007776 
[ PubMed ID = 30379819 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002 
[ PubMed ID = 27669035 ] [ RRC reference ]

Lemmens B, van Schendel R, Tijsterman M.
Mutagenic consequences of a single G-quadruplex demonstrate mitotic inheritance of DNA replication fork barriers.
Nat Commun 2015 6 8909 
[ PubMed ID = 26563448 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A.
Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases.
PLoS Genet 2013 9(7) e1003591 
[ PubMed ID = 23901331 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet 2013 9(7) e1003582 
[ PubMed ID = 23874209 ] [ RRC reference ]

Saito TT, Youds JL, Boulton SJ, Colaiácovo MP.
Caenorhabditis elegans HIM-18/SLX-4 interacts with SLX-1 and XPF-1 and maintains genomic integrity in the germline by processing recombination intermediates.
PLoS Genet 2009 5(11) e1000735 
[ PubMed ID = 19936019 ] [ RRC reference ]

Ward JD, Barber LJ, Petalcorin MI, Yanowitz J, Boulton SJ.
Replication blocking lesions present a unique substrate for homologous recombination.
EMBO J 2007 26(14) 3384-96 
[ PubMed ID = 17611606 ] [ RRC reference ]