分離済み変異体

tm1919

Allele Nametm1919
BalanceNot Required
OutCrossNot Accepted
Sequence NameK02G10.7
Gene Nameaqp-8
Worm BaseAllele Name tm1919
Gene Name aqp-8
Sequence K02G10.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J-C. Martinou: not hypersensitive nor hyperresistant to anoxia. Dr. C. Kenyon: normal lifespan. Dr. D.L. Baillie: resistant to osmotic stress.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 30855/30856-TAT-31340/31341 (485 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(29807..30103, 30675..30793, 31154..31412, 31461..31562))
Map position-6.87
Balancer
Map position of balancer
Sequence of primersExtRev:TGTAACTTGAGCACCCCTAA,IntRev:CATACTGGAATTGCGAGTCA,ExtFwd:CCACTACTGTCACTATACTC,IntFwd:CCTTTGGCTGGTTGAATGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Igual Gil C, Jarius M, von Kries JP, Rohlfing AK.
Neuronal Chemosensation and Osmotic Stress Response Converge in the Regulation of aqp-8 in C. elegans.
Front Physiol 2017 8 380 
[ PubMed ID = 28649202 ] [ RRC reference ]

Khan LA, Zhang H, Abraham N, Sun L, Fleming JT, Buechner M, Hall DH, Gobel V.
Intracellular lumen extension requires ERM-1-dependent apical membrane expansion and AQP-8-mediated flux.
Nat Cell Biol 2013 15(2) 143-56 
[ PubMed ID = 23334498 ] [ RRC reference ]

Mah AK, Armstrong KR, Chew DS, Chu JS, Tu DK, Johnsen RC, Chen N, Chamberlin HM, Baillie DL.
Transcriptional regulation of AQP-8, a Caenorhabditis elegans aquaporin exclusively expressed in the excretory system, by the POU homeobox transcription factor CEH-6.
J Biol Chem 2007 282(38) 28074-86 
[ PubMed ID = 17660295 ] [ RRC reference ]