分離済み変異体

tm1917

Allele Nametm1917
BalanceNot Required
OutCrossNot Accepted
Sequence NameC41D11.1
Gene Nameeri-6
Worm BaseAllele Name tm1917
Gene Name eri-6
Sequence C41D11.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvkun: no visbile phenotypes.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33298/33299-35149/35150 (1851 bp deletion)
ChromosomeI
Putative gene structurejoin(34408..34592, 34661..34754, 34805..34917, 34967..35153, 35210..35348, 35399..35505, 35551..35688)
Map position-1.28
Balancer
Map position of balancer
Sequence of primersExtRev:CCCAATAGGACGACGGTTTT,IntFwd:CCCGGTGGTCCTTGAATACA,IntRev:GTGTACCTTCTTGCGGTACG,ExtFwd:CGTGTCGGTGCCAACACAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Zhuang JJ, Hunter CP.
The Influence of Competition Among C. elegans Small RNA Pathways on Development.
Genes (Basel) 2012 3(4) 671-85 
[ PubMed ID = 23483754 ] [ RRC reference ]

Kumsta C, Hansen M.
C. elegans rrf-1 mutations maintain RNAi efficiency in the soma in addition to the germline.
PLoS One 2012 7(5) e35428 
[ PubMed ID = 22574120 ] [ RRC reference ]

Rosains J, Mango SE.
Genetic characterization of smg-8 mutants reveals no role in C. elegans nonsense mediated decay.
PLoS One 2012 7(11) e49490 
[ PubMed ID = 23166684 ] [ RRC reference ]

Zhuang JJ, Hunter CP.
Tissue specificity of Caenorhabditis elegans enhanced RNA interference mutants.
Genetics 2011 188(1) 235-7 
[ PubMed ID = 21385728 ] [ RRC reference ]

Fischer SE, Butler MD, Pan Q, Ruvkun G.
Trans-splicing in C. elegans generates the negative RNAi regulator ERI-6/7.
Nature 2008 455(7212) 491-6 
[ PubMed ID = 18784652 ] [ RRC reference ]