| Allele Name | tm1908 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T24D8.5 |
| Gene Name | nlp-2 |
| Worm Base | Allele Name |
tm1908
|
| Gene Name |
nlp-2
|
| Sequence |
T24D8.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 5714/5715-TT-6656/6657 (942 bp deletion + 2 bp insertion) |
| Chromosome | X |
| Putative gene structure | complement(join(5918..6161, 6216..6397, 6455..6544)) |
| Map position | -15.63 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:AATCGGACCCATACGTGCCT,ExtRev:CTACGGATACTTCAAGTGGT,ExtFwd:CGAACCGGCATACATTTAGT,IntRev:TGACCCGGCTCCTAATACTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Aviles S, Subramanian S, Nelson MD.
New alleles of nlp-2 , nlp-22 , and nlp-23 demonstrate that they are dispensable for stress-induced sleep in C. elegans.
MicroPubl Biol 2024 2024
[ PubMed ID = 38371321 ]
[ RRC reference ]
|
Van der Auwera P, Frooninckx L, Buscemi K, Vance RT, Watteyne J, Mirabeau O, Temmerman L, De Haes W, Fancsalszky L, Gottschalk A, Raizen DM, Nelson MD, Schoofs L, Beets I.
RPamide neuropeptides NLP-22 and NLP-2 act through GnRH-like receptors to promote sleep and wakefulness in C. elegans.
Sci Rep 2020 10(1) 9929
[ PubMed ID = 32555288 ]
[ RRC reference ]
|
Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.