| Allele Name | tm1906 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | C27A12.10 |
| Gene Name | mbd-2 |
| Worm Base | Allele Name |
tm1906
(x1) |
| Gene Name |
mbd-2
|
| Sequence |
C27A12.10
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 27135/27136-TAGGAAGAATCC-28912/28913 (1777 bp deletion + 11 bp insertion) |
| Chromosome | I |
| Putative gene structure | join(27572..27751, 27884..28009, 28137..28361, 28544..28645) |
| Map position | 0.74 |
| Balancer | hT2,hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtRev:TATCGAACGGGATGTGGTCT,IntFwd:ACACGAGAGTAACGAGTGAT,ExtFwd:AACGGTTTCCGAGGGCGCAA,IntRev:ATTCCGATGGGAGTGCCAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ihara S, Nakayama S, Murakami Y, Suzuki E, Asakawa M, Kinoshita T, Sawa H. PIGN prevents protein aggregation in the endoplasmic reticulum independently of its function in the GPI synthesis. J Cell Sci 2017 130(3) 602-613
[ PubMed ID = 27980068 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
|