分離済み変異体

tm1905

Allele Nametm1905
BalanceCompleted
OutCrossNot Accepted
Sequence NameY17G7B.2
Gene Nameash-2
Worm BaseAllele Name tm1905 (x1)
Gene Name ash-2
Sequence Y17G7B.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H.C. Korswagen: lin-22-like multiple postdeirid phenotypes. Dr. O. Hobert: does not affect ASE development.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11628/11629-12229/12230 (601 bp deletion)
ChromosomeII
Putative gene structurejoin(11683..11753, 11836..11928, 11980..12304, 13242..13462, 14218..14331, 15865..16127, 17187..17299, 18228..18428, 18624..18714, 19438..19658)
Map position5.54
Balancer,mIn1 [e128 mIs14]
Map position of balancer
Sequence of primersExtFwd:TTCGACGGCGAGGCGATTGT,IntFwd:GTCGCGGTCGATAAGCACTC,ExtRev:CGTGGCTCACGGTTTTCCCT,IntRev:CTGCCTCGTGTAGTGGTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Liu F, Wang Q, Xiong J, Wang M, Zhou H, Xiao Y.
Parental S-adenosylmethionine diet defines offspring immune response via histone H3K4me3 complex and Endoplasmic Reticulum UPR.
Cell Commun Signal 2025 23(1) 397 
[ PubMed ID = 40993686 ] [ RRC reference ]

Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13  
[ PubMed ID = 39951337 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Abay-Nørgaard S, Tapia MC, Zeijdner M, Kim JH, Won KJ, Porse B, Salcini AE.
Inter and transgenerational impact of H3K4 methylation in neuronal homeostasis.
Life Sci Alliance 2023 6(8)  
[ PubMed ID = 37225426 ] [ RRC reference ]

Abay-Nørgaard S, Attianese B, Boreggio L, Salcini AE.
Regulators of H3K4 methylation mutated in neurodevelopmental disorders control axon guidance in Caenorhabditis elegans.
Development 2020 147(15)  
[ PubMed ID = 32675280 ] [ RRC reference ]

Nono M, Kishimoto S, Sato-Carlton A, Carlton PM, Nishida E, Uno M.
Intestine-to-Germline Transmission of Epigenetic Information Intergenerationally Ensures Systemic Stress Resistance in C. elegans.
Cell Rep 2020 30(10) 3207-3217.e4 
[ PubMed ID = 32160530 ] [ RRC reference ]

Robert VJ, Mercier MG, Bedet C, Janczarski S, Merlet J, Garvis S, Ciosk R, Palladino F.
The SET-2/SET1 histone H3K4 methyltransferase maintains pluripotency in the Caenorhabditis elegans germline.
Cell Rep 2014 9(2) 443-50 
[ PubMed ID = 25310986 ] [ RRC reference ]

Zuryn S, Ahier A, Portoso M, White ER, Morin MC, Margueron R, Jarriault S.
Transdifferentiation. Sequential histone-modifying activities determine the robustness of transdifferentiation.
Science 2014 345(6198) 826-9 
[ PubMed ID = 25124442 ] [ RRC reference ]

Wang S, Fisher K, Poulin GB.
Lineage specific trimethylation of H3 on lysine 4 during C. elegans early embryogenesis.
Dev Biol 2011 355(2) 227-38 
[ PubMed ID = 21549110 ] [ RRC reference ]

Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O.
A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans.
PLoS Genet 2011 7(6) e1002109 
[ PubMed ID = 21698137 ] [ RRC reference ]

Xiao Y, Bedet C, Robert VJ, Simonet T, Dunkelbarger S, Rakotomalala C, Soete G, Korswagen HC, Strome S, Palladino F.
Caenorhabditis elegans chromatin-associated proteins SET-2 and ASH-2 are differentially required for histone H3 Lys 4 methylation in embryos and adult germ cells.
Proc Natl Acad Sci U S A 2011 108(20) 8305-10 
[ PubMed ID = 21527717 ] [ RRC reference ]