| Allele Name | tm1903 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y17G7B.2 |
| Gene Name | ash-2 |
| Worm Base | Allele Name |
tm1903
(x1) |
| Gene Name |
ash-2
|
| Sequence |
Y17G7B.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. H.C. Korswagen: lin-22-like multiple postdeirid phenotypes. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12283/12284-12780/12781 (497 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(11683..11753, 11836..11928, 11980..12304, 13242..13462, 14218..14331, 15865..16127, 17187..17299, 18228..18428, 18624..18714, 19438..19658) |
| Map position | 5.54 |
| Balancer | ,mIn1 [e128 mIs14] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TTCGACGGCGAGGCGATTGT,IntFwd:GTCGCGGTCGATAAGCACTC,ExtRev:CGTGGCTCACGGTTTTCCCT,IntRev:CTGCCTCGTGTAGTGGTCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ]
[ RRC reference ]
|
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.