分離済み変異体

tm1898

Allele Nametm1898
BalanceNot Required
OutCrossNot Accepted
Sequence NameT27C10.6
Gene Namelrk-1
Worm BaseAllele Name tm1898
Gene Name lrk-1
Sequence T27C10.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Jin: very weak defect in SNB-1-gfp expression. Dr. K. Shen: normal formation of presynaptic sites in DA9 as determined by VAMP and RAB-3 localization. Dr. H. Suzuki: normal chemotaxis to NaCl. Dr. E. Schmidt: J. Biol. Chem. in press.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13741/13742-CGTCGTCGT-14118/14119 (377 bp deletion + 9 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(6182..6341, 6535..6710, 6757..7215, 7869..7958, 8009..9440, 9495..9671, 10365..10597, 10843..11614, 11662..13013, 13060..13409, 13458..14302, 14348..14466, 14837..15005, 15057..15273, 18417..18613, 18837..18899, 18944..19055, 19165..19362, 20153..20309, 20357..20443))
Map position5.54
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCAGAAGCCGGGGACATGT,IntFwd:ACATGTGCATGCCAGGCAGA,ExtRev:ACGAGGGCTCTACGTGTCTA,IntRev:TCTACATTGGGCCGCCCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bae EJ, Kim DK, Kim C, Mante M, Adame A, Rockenstein E, Ulusoy A, Klinkenberg M, Jeong GR, Bae JR, Lee C, Lee HJ, Lee BD, Di Monte DA, Masliah E, Lee SJ.
LRRK2 kinase regulates α-synuclein propagation via RAB35 phosphorylation.
Nat Commun 2018 9(1) 3465 
[ PubMed ID = 30150626 ] [ RRC reference ]

Laurent P, Ch'ng Q, Jospin M, Chen C, Lorenzo R, de Bono M.
Genetic dissection of neuropeptide cell biology at high and low activity in a defined sensory neuron.
Proc Natl Acad Sci U S A 2018 115(29) E6890-E6899 
[ PubMed ID = 29959203 ] [ RRC reference ]

Martinez BA, Petersen DA, Gaeta AL, Stanley SP, Caldwell GA, Caldwell KA.
Dysregulation of the Mitochondrial Unfolded Protein Response Induces Non-Apoptotic Dopaminergic Neurodegeneration in C. elegans Models of Parkinson's Disease.
J Neurosci 2017 37(46) 11085-11100 
[ PubMed ID = 29030433 ] [ RRC reference ]

Maulik M, Mitra S, Bult-Ito A, Taylor BE, Vayndorf EM.
Behavioral Phenotyping and Pathological Indicators of Parkinson's Disease in C. elegans Models.
Front Genet 2017 8 77 
[ PubMed ID = 28659967 ] [ RRC reference ]

Kuwahara T, Inoue K, D'Agati VD, Fujimoto T, Eguchi T, Saha S, Wolozin B, Iwatsubo T, Abeliovich A.
LRRK2 and RAB7L1 coordinately regulate axonal morphology and lysosome integrity in diverse cellular contexts.
Sci Rep 2016 6 29945 
[ PubMed ID = 27424887 ] [ RRC reference ]

Yao C, Johnson WM, Gao Y, Wang W, Zhang J, Deak M, Alessi DR, Zhu X, Mieyal JJ, Roder H, Wilson-Delfosse AL, Chen SG.
Kinase inhibitors arrest neurodegeneration in cell and C. elegans models of LRRK2 toxicity.
Hum Mol Genet 2013 22(2) 328-44 
[ PubMed ID = 23065705 ] [ RRC reference ]

Yuan Y, Cao P, Smith MA, Kramp K, Huang Y, Hisamoto N, Matsumoto K, Hatzoglou M, Jin H, Feng Z.
Dysregulated LRRK2 signaling in response to endoplasmic reticulum stress leads to dopaminergic neuron degeneration in C. elegans.
PLoS One 2011 6(8) e22354 
[ PubMed ID = 21857923 ] [ RRC reference ]

Harrington AJ, Hamamichi S, Caldwell GA, Caldwell KA.
C. elegans as a model organism to investigate molecular pathways involved with Parkinson's disease.
Dev Dyn 2010 239(5) 1282-95 
[ PubMed ID = 20108318 ] [ RRC reference ]

Sämann J, Hegermann J, von Gromoff E, Eimer S, Baumeister R, Schmidt E.
Caenorhabditits elegans LRK-1 and PINK-1 act antagonistically in stress response and neurite outgrowth.
J Biol Chem 2009 284(24) 16482-16491 
[ PubMed ID = 19251702 ] [ RRC reference ]