Home > 分離済み変異体 > tm1896

分離済み変異体

Allele Name		tm1896
Balance		Not Required
OutCross		Not Accepted
Sequence Name		T16H5.1
Gene Name		inx-19
Worm Base	Allele Name	tm1896
	Gene Name	inx-19
	Sequence	T16H5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. H. Sawa: Some die in embryonic stage (10/100). Dr. C. Bargmann: Cell 129, 787 (2007)
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2908/2909-3454/3455 (546 bp deletion)
Chromosome		I
Putative gene structure		complement(join(169..372, 1137..1547, 2853..3089, 3214..3287, 4249..4658, 11541..11569))
Map position		-8.61
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GCTACTTTTGAGGCACGCAT,IntFwd:GAGGCACGCATTGAGTATCA,ExtRev:CATTCTGTGCCTGGGAGACA,IntRev:ATAGGTGGCCGAACCGTTCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Rosero M, Bai J. AFD Thermosensory Neurons Mediate Tactile-Dependent Locomotion Modulation in C. elegans. bioRxiv 2025    [ PubMed ID = 40060420 ] [ RRC reference ] Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S. A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2024 121(21) e2406565121  [ PubMed ID = 38753507 ] [ RRC reference ] Tang LTH, Lee GA, Cook SJ, Ho J, Potter CC, Bülow HE. Anatomical restructuring of a lateralized neural circuit during associative learning by asymmetric insulin signaling. Curr Biol 2023 33(18) 3835-3850.e6  [ PubMed ID = 37591249 ] [ RRC reference ] Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P. Locomotion modulates olfactory learning through proprioception in C. elegans. Nat Commun 2023 14(1) 4534  [ PubMed ID = 37500635 ] [ RRC reference ] Voelker L, Upadhyaya B, Ferkey DM, Woldemariam S, L'Etoile ND, Rabinowitch I, Bai J. INX-18 and INX-19 play distinct roles in electrical synapses that modulate aversive behavior in Caenorhabditis elegans. PLoS Genet 2019 15(10) e1008341  [ PubMed ID = 31658255 ] [ RRC reference ] Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272  [ PubMed ID = 28143932 ] [ RRC reference ] Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW. Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 2013 8(10) e76877  [ PubMed ID = 24130800 ] [ RRC reference ] Altun ZF, Chen B, Wang ZW, Hall DH. High resolution map of Caenorhabditis elegans gap junction proteins. Dev Dyn 2009 238(8) 1936-50  [ PubMed ID = 19621339 ] [ RRC reference ] Starich TA, Xu J, Skerrett IM, Nicholson BJ, Shaw JE. Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system. Neural Dev 2009 4 16  [ PubMed ID = 19432959 ] [ RRC reference ] Chuang CF, Vanhoven MK, Fetter RD, Verselis VK, Bargmann CI. An innexin-dependent cell network establishes left-right neuronal asymmetry in C. elegans. Cell 2007 129(4) 787-99  [ PubMed ID = 17512411 ] [ RRC reference ]