| Allele Name | tm1890 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C10F3.2 |
| Gene Name | dhs-16 |
| Worm Base | Allele Name |
tm1890
|
| Gene Name |
dhs-16
|
| Sequence |
C10F3.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. A. Antebi: gonadal Mig on low cholesterol. Dr. C. Loer: not serotonin deficient nor alkaline bleach hypersensitive. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 23034/23035-23641/23642 (607 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(23219..23419, 23758..24328, 24415..24809) |
| Map position | -0.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TCCTAGATAGGTGGAGGGTA,ExtFwd:CAGGGCGGAGCATACCTATT,IntRev:GAATCGCAGAACGACGCTTC,ExtRev:CGATATCAAGTACGGTGGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ]
[ RRC reference ]
|
Mahanti P, Bose N, Bethke A, Judkins JC, Wollam J, Dumas KJ, Zimmerman AM, Campbell SL, Hu PJ, Antebi A, Schroeder FC.
Comparative metabolomics reveals endogenous ligands of DAF-12, a nuclear hormone receptor, regulating C. elegans development and lifespan.
Cell Metab 2014 19(1) 73-83
[ PubMed ID = 24411940 ]
[ RRC reference ]
|
Wollam J, Magner DB, Magomedova L, Rass E, Shen Y, Rottiers V, Habermann B, Cummins CL, Antebi A.
A novel 3-hydroxysteroid dehydrogenase that regulates reproductive development and longevity.
PLoS Biol 2012 10(4) e1001305
[ PubMed ID = 22505847 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.