分離済み変異体

tm1889

Allele Nametm1889
BalanceCompleted
OutCrossNot Accepted
Sequence NameY48G1A.5
Gene Namexpo-2
Worm BaseAllele Name tm1889 (x1)
Gene Name xpo-2
Sequence Y48G1A.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7671/7672-G-8525/8526 (854 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(4415..4718, 5328..6007, 6665..7978, 8375..8683, 8733..8942))
Map position-19.08
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:TGCACCGAATCCGCCGGATT,IntFwd:GACTCGACCAACTGTGCGAG,ExtRev:CCGGATGCTGCGATTCGCAA,IntRev:CCGCTCGCTGCAATCAAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol 2014 122 277-310 
[ PubMed ID = 24857735 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]