分離済み変異体

tm1888

Allele Name

tm1888

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F13B12.5

Gene Name

ins-1

Worm Base

Allele Name

tm1888 (x1)

Gene Name

ins-1

Sequence

F13B12.5

Phenotype

homozygous viable. Dr. S. Tuck: does not affect rsks-1 gene. L. Avery: intact satiety behavior. Dr. S. Tuck: Cell 128, 577-587 (2007). Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response.

Mutation site

21217/21218-21965/21966 (748 bp deletion)

Chromosome

Putative gene structure

join(20800..20825, 20912..21063, 21887..22038)

Map position

4.59

Balancer

Map position of balancer

Sequence of primers

IntRev:TCCGGTGAGCTGCCAACGAT,ExtRev:GGATGCATCAGACGACTGTG,IntFwd:GCAGACAGGAAATCATCTAC,ExtFwd:GTCCTGACTGCAAACGAGCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW.
Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(40) e2405391121
[ PubMed ID = 39316052 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW.
Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
bioRxiv 2024
[ PubMed ID = 38586049 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628
[ PubMed ID = 37008778 ] [ RRC reference ]

Segref A, Vakkayil KL, Padvitski T, Li Q, Kroef V, Lormann J, Körner L, Finger F, Hoppe T.
Thermosensation in Caenorhabditis elegans is linked to ubiquitin-dependent protein turnover via insulin and calcineurin signalling.
Nat Commun 2022 13(1) 5874
[ PubMed ID = 36198694 ] [ RRC reference ]

Handley A, Wu Q, Sherry T, Cornell R, Pocock R.
Diet-responsive transcriptional regulation of insulin in a single neuron controls systemic metabolism.
PLoS Biol 2022 20(5) e3001655
[ PubMed ID = 35594303 ] [ RRC reference ]

Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S.
Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34477553 ] [ RRC reference ]

Saito R, Shinkai Y, Doi M.
Intestinal F-box protein regulates quick avoidance behavior of Caenorhabditis elegans to the pathogenic bacterium Pseudomonas aeruginosa.
Genes Cells 2019 24(3) 192-201
[ PubMed ID = 30589496 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)
[ PubMed ID = 29925517 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Dwyer DS, Aamodt EJ.
Insulin/IGF-1 signaling, including class II/III PI3Ks, β-arrestin and SGK-1, is required in C. elegans to maintain pharyngeal muscle performance during starvation.
PLoS One 2013 8(5) e63851
[ PubMed ID = 23700438 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS One 2011 6(7) e21897
[ PubMed ID = 21814562 ] [ RRC reference ]

Kao G, Nordenson C, Still M, Rönnlund A, Tuck S, Naredi P.
ASNA-1 positively regulates insulin secretion in C. elegans and mammalian cells.
Cell 2007 128(3) 577-87
[ PubMed ID = 17289575 ] [ RRC reference ]