分離済み変異体

tm1875

Allele Nametm1875
Allele Type通常株
Sequence NameM04D8.3
Gene Nameins-23
Worm BaseAllele Name tm1875
Gene Name ins-23
Sequence M04D8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. Dr. J. Hubbard: no dauer formation at 20 & 25 C. Dr. P. Roy: normal muscle arm development. Dr. K. Ashrafi: slightly increased Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. Q.L. Ch'ng: normal locomotion and egg-laying.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10323/10324-GACGGAGC-11607/11608 (1284 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurejoin(11143..11290, 11349..11431)
Map position1.62
Balancer
Map position of balancer
Sequence of primersExtRev:ACCCATTCTGGCCATCTTGC,IntRev:TGGCTCTGACCCGGCCAATT,ExtFwd:ACGTGTCAAAGAAGCCCCTT,IntFwd:CGCCAAAGATCCGATTGTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5 
[ PubMed ID = 31676170 ] [ RRC reference ]

Matsunaga Y, Matsukawa T, Iwasaki T, Nagata K, Kawano T.
Comparison of physiological functions of antagonistic insulin-like peptides, INS-23 and INS-18, in Caenorhabditis elegans.
Biosci Biotechnol Biochem 2018 82(1) 90-96 
[ PubMed ID = 29303423 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]