分離済み変異体

tm1875

Allele Name

tm1875

Balance

Not Required

OutCross

Not Accepted

Sequence Name

M04D8.3

Gene Name

ins-23

Worm Base

Allele Name

tm1875

Gene Name

ins-23

Sequence

M04D8.3

Phenotype

homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. Dr. J. Hubbard: no dauer formation at 20 & 25 C. Dr. P. Roy: normal muscle arm development. Dr. K. Ashrafi: slightly increased Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. Q.L. Ch'ng: normal locomotion and egg-laying.

Mutation site

10323/10324-GACGGAGC-11607/11608 (1284 bp deletion + 8 bp insertion)

Chromosome

III

Putative gene structure

join(11143..11290, 11349..11431)

Map position

1.62

Balancer

Map position of balancer

Sequence of primers

ExtRev:ACCCATTCTGGCCATCTTGC,IntRev:TGGCTCTGACCCGGCCAATT,ExtFwd:ACGTGTCAAAGAAGCCCCTT,IntFwd:CGCCAAAGATCCGATTGTGT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Xue W, Chen Y, Lei Z, Wang Y, Liu J, Wen X, Xu F, Chen P, Wu Z, Jin YN, Yu YV.
Calcium levels in ASER neurons determine behavioral valence by engaging distinct neuronal circuits in C. elegans.
Nat Commun 2025 16(1) 1814
[ PubMed ID = 39979341 ] [ RRC reference ]

Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121
[ PubMed ID = 38753507 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178
[ PubMed ID = 35511794 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5
[ PubMed ID = 31676170 ] [ RRC reference ]

Matsunaga Y, Matsukawa T, Iwasaki T, Nagata K, Kawano T.
Comparison of physiological functions of antagonistic insulin-like peptides, INS-23 and INS-18, in Caenorhabditis elegans.
Biosci Biotechnol Biochem 2018 82(1) 90-96
[ PubMed ID = 29303423 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]