分離済み変異体

tm1867

Allele Nametm1867
BalanceNot Required
OutCrossNot Accepted
Sequence NameF41G3.4
Gene Namefis-1
Worm BaseAllele Name tm1867
Gene Name fis-1
Sequence F41G3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. van der Bliek: normal locomotion, wild-type mitochondria in muscle and hypodermal cells. Dr. H-S. Koo: adult worms contain several embryos later than 2-fold stage. Dr. D. Xue: Mol Cell 31, 586 (2008)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14939/14940-15483/15484 (544 bp deletion)
ChromosomeII
Putative gene structurejoin(15295..15345, 15387..15495, 15543..15622, 15808..15999)
Map position0.08
Balancer
Map position of balancer
Sequence of primersIntFwd:CTCCACCAACTAGGCTTATC,ExtFwd:CCAGGTAGCATTGCGTTAAG,IntRev:TAGAGCATGCGTTCAAGGTA,ExtRev:CCCGAGAGCCGGAGTGTTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y.
A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans.
Front Neurosci 2017 11 263 
[ PubMed ID = 28539870 ] [ RRC reference ]

Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol Biol Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]

Bess AS, Leung MC, Ryde IT, Rooney JP, Hinton DE, Meyer JN.
Effects of mutations in mitochondrial dynamics-related genes on the mitochondrial response to ultraviolet C radiation in developing Caenorhabditis elegans.
Worm 2013 2(1) e23763 
[ PubMed ID = 24058863 ] [ RRC reference ]

Breckenridge DG, Kang BH, Kokel D, Mitani S, Staehelin LA, Xue D.
Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9.
Mol Cell 2008 31(4) 586-597 
[ PubMed ID = 18722182 ] [ RRC reference ]